Melaleuca nodosa

(Gaertn.) Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records6 773

Data sources11

Biological traits49

DNA specimens3

eDNA detections1

Sources11 archives

Databases and archives Melaleuca nodosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 773 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources49 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF6 773 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Melaleuca nodosa adalah sebuah tumbuhan dalam famili Myrtaceae dan merupakan endemik di timurn Australia. Tumbuhan tersebut menampilkan bunga-bunga kuning pada awal April atau akhir Januari.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology20

Fruit length2.5 mm

Fruit width2.5 mm

Leaf length25 mm

Leaf length max40 mm

Leaf length min10 mm

Leaf mass2.8 mg

Leaf mass per area188 g/m2

Leaf size22.89 mm²

⚠ sources differ — TRY: 22.89 mm² · AusTraits: 21.69 mm²

Leaf width2 mm

Leaf width max3 mm

Leaf width min1 mm

Petiole length0.1 cm

Plant height2.5 m

Plant height max4 m

Plant height min1 m

Seed length0.86 mm

Seed mass0.07 mg

⚠ sources differ — TRY: 0.07 mg · AusTraits: 0.079 mg · GIFT: 0.075 mg

Seed mass max0.104 mg

Seed mass min0.05 mg

Seed width0.5 mm

Life cycle & reproduction8

Deciduousnessevergreen

Flowering timennnnnnnnyynn

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Reproductive maturity4 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub

Leaf compoundnesssimple

Leaf shapelinear oblong terete

Mycorrhiza typeectomycorrhizal

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio34.46 g/g

Leaf c458 mg/g

Leaf n7.6 mg/g

Leaf p0.4 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)3.98 mm²/mg

Wood density616 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Melaleuca nodosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Simple cyclic polyketides1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Leptospermone		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca nodosa has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF294592.1 ↗255 bp

ACGT

AGAATGACCAGAGAACTAGTAACAAACTCGATGGGGGCGGTGGGCTTCGCCTATCGTCTCCTGACGCTTGGATCGCACGAGTGCCTAGAG …

Melaleuca nodosa internal transcribed spacer 1, and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Melaleuca nodosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · book-ipcn75-78 · CCDB · book-fedorov

CCDB · book-ipcn75-78 — Brighton

CCDB · book-fedorov — Smith-White 1948a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type6 773 records

Wild obs. + sensor5 957

Museum / vouchered632

Cultivated / captive4

Other180

Origin

Native213

Introduced2

Range

Area of Occupancy AOO7 576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 5 069≤1 km 555≤10 km 94>10 km 28

5 746 georeferenced · 211 without coordinates

Open the mapobservation + sensor5 957

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 91≤1 km 114≤10 km 267>10 km 89

561 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence632

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 3 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	213
Brisbane, AU	138
Canberra, AU	115
Museo Entomologico de Leonlocation not on record	58
Armidale, AU	30
Adelaide, AU	13
NSW Dept of Planning, Industry and Environmentlocation not on record	12
Wollongong, AU	9
John T. Waterhouse Herbariumlocation not on record	8
Kew, GB	7
Hobart, AU	4
Smithfield, AU	3
Kensington, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
IPA/SPlocation not on record	1
Miami, US	1
University of Stellenboschlocation not on record	1
James Cook Townsvillelocation not on record	1
Christchurch, NZ	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Auckland, NZ	1
Tampa, US	1
Riverside, US	1
La Trobe Universitylocation not on record	1

24 institutions · 623 of 632 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Melaleuca nodosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 22.4–22.4

Seasonal swing summer↔winter8.90 °C

Max temp (day)25.4 °C

Min temp (night)19.6 °C

Precipitation134 mm/mo

Air humidity59.7 %

Moisture balance-27.6 mm/mo

Vapour deficit1,082 Pa

Wind speed2.60 m/s

Cloud cover21.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Melaleuca nodosa

At a glance

Sources11 archives

Size & morphology20

Life cycle & reproduction8

Diet & foraging1

Habitat & environment11

Physiology & chemistry8

Other traits1

Compound class profile1 class

Documented compounds1 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type6 773 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 24 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 773 records