Melaleuca nervosa

(Lindl.) Cheel · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records3 686

Data sources7

Biological traits39

DNA specimens7

eDNA detections7

Sources7 archives

Databases and archives Melaleuca nervosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 686 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources39 traits

Occurrence & distributionGBIF3 686 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Melaleuca nervosa est une espèce de plantes à fleur de la famille des Myrtaceae. C'est un arbuste, ou un petit arbre, à feuilles étroites, qui fleurit jaune-vert ou rouge. Comme d'autres Melaleuca, cette espèce a de nombreuses utilisations pour les aborigènes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit length3.75 mm

Fruit width3.75 mm

Leaf length72.5 mm

Leaf mass per area158 g/m2

Leaf size753 mm²

Leaf width17.5 mm

Petiole length0.75 cm

Plant height7 m

⚠ sources differ — AusTraits: 7 m · TRY: 3.9 m

Plant height max10 m

Plant height min1.5 m

Seed mass0.06 mg

⚠ sources differ — TRY: 0.06 mg · AusTraits: 0.089 mg · GIFT: 0.117 mg

Seed mass max0.17 mg

Seed mass min0.04 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timennnyyyyyynnn

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry7

Leaf dry-matter content (LDMC)314 mg/g

Leaf n9.96 mg/g

Leaf p0.83 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.59 mm²/mg

Wood density687 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca nervosa has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences10

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW139126.1 ↗312 bp

ACGT

CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCATAACCATCTGGTGAGGGCACGTTTGCCTGGGTGTCACACATGGCGTTGCCCCT …

Melaleuca nervosa isolate Mel-ner-seq2 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS8★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type3 686 records

Wild obs. + sensor2 153

Museum / vouchered1 087

Cultivated / captive3

Other443

Origin

Native166

Range

Area of Occupancy AOO9 180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 1 529≤1 km 24≤10 km 15>10 km 4

1 572 georeferenced · 581 without coordinates

Open the mapobservation + sensor2 153

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 140≤1 km 233≤10 km 451>10 km 95

919 georeferenced · 168 without coordinates

Open the institutions mapphysical evidence1 087

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	324
Palmerston, AU	233
Museo Entomologico de Leonlocation not on record	135
Mount Annan, AU	117
Smithfield, AU	70
Adelaide, AU	38
Kew, GB	26
Kensington, AU	19
James Cook Townsvillelocation not on record	12
Armidale, AU	8
BGPAlocation not on record	8
John T. Waterhouse Herbariumlocation not on record	7
Brisbane, AU	5
Hobart, AU	5
Honolulu, US	4
BISHlocation not on record	3
Auckland, NZ	2
Parkville, AU	1
University of Stellenboschlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Stockholm, SE	1
Cambridge University Herbariumlocation not on record	1
Taipei, TW	1

23 institutions · 1 022 of 1 087 vouchered records shown · 62 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Melaleuca nervosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 24.1–26.5

Seasonal swing summer↔winter8.10 °C

Max temp (day)29.6 °C 26.5–30.4

Min temp (night)23.7 °C 19.1–24.4

Precipitation53.3 mm/mo 47.6–175

Air humidity53.9 % 53.7–60.8

Moisture balance-92.9 mm/mo

Vapour deficit1,398 Pa 1,238–1,570

Wind speed4.50 m/s

Cloud cover34.1 % 28.7–42.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Melaleuca nervosa

At a glance

Sources7 archives

Size & morphology13

Life cycle & reproduction7

Diet & foraging1

Habitat & environment10

Physiology & chemistry7

Other traits1

At a glance

Record type3 686 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 23 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 686 records