Melaleuca linariifolia

Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records5 487

Data sources15

Biological traits42

DNA specimens13

eDNA detections9

Sources15 archives

Databases and archives Melaleuca linariifolia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 487 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources42 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS59 compounds

Occurrence & distributionGBIF5 487 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Melaleuca linariifolia is a plant in the myrtle family Myrtaceae, and is endemic to eastern Australia. It is commonly known as snow-in-summer, narrow-leaved paperbark, flax-leaved paperbark and in the language of the Gadigal people as budjur. A hardy plant, it flowers prolifically in late spring or summer, making it a popular garden shrub or small tree in temperate places. Melaleuca trichostachya is a similar species but its leaves are arranged differently and the fruits have projecting valves.Street trees in Albany, California

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology16

Fruit length2.5 mm

Fruit width3.5 mm

Leaf length22.5 mm

Leaf length max45 mm

Leaf length min20 mm

Leaf mass per area132 g/m2

Leaf width2 mm

Leaf width max3.5 mm

Leaf width min2 mm

Petiole length0.1 cm

Plant height10 m

Plant height max10 m

Plant height min2 m

Seed mass0.02 mg

⚠ sources differ — TRY: 0.02 mg · AusTraits: 0.02 mg · GIFT: 0.01 mg

Seed mass max0.01 mg

Seed mass min0.01 mg

Life cycle & reproduction11

Deciduousnessevergreen

Dispersal typewind

Flowering timeyynnnnnnyyyy

Life formshrub or tree

Life spanperennial

Lifespan years150 years

⚠ sources differ — TRY: 150 years · AusTraits: 105 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproductive maturity4 years

Resprouting capacityresprouts

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapelanceolate linear narrowly_elliptical

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)7.55 mm²/mg

Wood density682 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition59 compounds

Compounds documented for Melaleuca linariifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Terpenoid alkaloids8

Menthane monoterpenoids5

Monocyclic monoterpenoids4

Aromadendrane sesquiterpenoids4

Menthane monoterpenoids $ Monocyclic monoterpenoids3

Documented compounds59 total

Tissue Source Quantified only

Compound	Amount	Source
EO	20,000 ppm	DukesPhytochem
CINEOLE	12,300 ppm	DukesPhytochem
TERPENES	9,000 ppm	DukesPhytochem
TERPINEN-4-OL	7,400 ppm	DukesPhytochem
SESQUITERPENES	1,200 ppm	DukesPhytochem
TERPINOLENE	750 ppm	DukesPhytochem
ALPHA-PINENE	400 ppm	DukesPhytochem
BETA-PINENE	200 ppm	DukesPhytochem
ALPHA-THUJENE	200 ppm	DukesPhytochem
P-CYMENE	200 ppm	DukesPhytochem

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca linariifolia has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes6

GenBank sequences10

eDNA detections9

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOL536563.1 ↗325 bpUSA · 2018

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGTAACCATCCGGTGAGGGCACGTTTGCCTGGGTGTCACACATGG …

Melaleuca linariifolia voucher MO:Carlsen3253 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK7★rbcL2★rbcLa★ITS1★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Melaleuca linariifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-fedorov

CCDB · book-fedorov — Smith-White 1948a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type5 487 records

Wild obs. + sensor4 916

Museum / vouchered430

Cultivated / captive10

Other131

Origin

Native132

Introduced65

Range

Area of Occupancy AOO9 232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 3 937≤1 km 604≤10 km 243>10 km 27

4 811 georeferenced · 105 without coordinates

Open the mapobservation + sensor4 916

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 34≤1 km 77≤10 km 167>10 km 42

320 georeferenced · 110 without coordinates

Open the institutions mapphysical evidence430

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy83% within 1 km

≤100 m 3≤1 km 2≤10 km 1

6 georeferenced · 4 without coordinates

Open the mapnot free-living10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions32 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	138
Canberra, AU	69
Museo Entomologico de Leonlocation not on record	37
Brisbane, AU	26
Adelaide, AU	19
Rotorua, NZ	12
NSW Dept of Planning, Industry and Environmentlocation not on record	11
Smithfield, AU	9
Tampa, US	8
Armidale, AU	7
Wollongong, AU	7
Cape Town, ZA	6
Auckland, NZ	6
Durban, ZA	6
James Cook Townsvillelocation not on record	6
University of Stellenboschlocation not on record	5
Santa Barbara, US	4
Canadian Department of Agriculturelocation not on record	4
Kensington, AU	4
Kew, GB	3
Hobart, AU	3
Bronx, US	2
Taipei, TW	2
Cape Town, ZA	2
Saint Louis, US	2
John T. Waterhouse Herbariumlocation not on record	2
Riverside, US	2
Palmerston, AU	2
Altos de Pipe, VE	2
IPA/SPlocation not on record	1
US	1
Davis, US	1
Claremont, US	1
Berlin, DE	1
Miami, US	1
Christchurch, NZ	1
Minia, EG	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
CASlocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1
Sagamihara, JP	1
Antiguo Cuscatlán, SV	1

43 institutions · 420 of 430 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA9 detections

Where the DNA of Melaleuca linariifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 17.5–18.6

Seasonal swing summer↔winter18.3 °C

Max temp (day)23.3 °C 22.6–24.0

Min temp (night)13.0 °C 12.1–13.8

Precipitation129 mm/mo 120–138

Air humidity57.0 % 56.7–57.4

Moisture balance-24.3 mm/mo -37.6–-11.0

Vapour deficit891 Pa 853–930

Wind speed3.40 m/s

Cloud cover26.9 % 15.7–38.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Melaleuca linariifolia

At a glance

Sources15 archives

Size & morphology16

Life cycle & reproduction11

Diet & foraging1

Habitat & environment9

Physiology & chemistry4

Other traits1

Compound class profile5 classes

Documented compounds59 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 487 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions32 of 43 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 487 records