Melaleuca lasiandra

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records579

Data sources7

Biological traits26

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Melaleuca lasiandra's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility579 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF579 records

DNA & barcodingNCBIsequences

01Narrative

Melaleuca lasiandra is a plant in the myrtle family, Myrtaceae and is native to the northern inland of Australia. Its foliage is covered with soft, silky hairs giving the leaves a silvery-grey appearance and even the filaments of the stamens are hairy.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Plant height2.8 m

Plant height max5 m

Plant height min0.6 m

Seed mass0.267 mg

⚠ sources differ — TRY: 0.267 mg · AusTraits: 0.293 mg · GIFT: 0.29 mg

Seed mass max0.38 mg

Seed mass min0.2 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeself

Flowering timennnyyyyyyyyy

Life formshrub or tree

Life spanperennial

Pollination syndromebird+insect+mammal

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca lasiandra has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF048874.1 ↗277 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAATGACCAGAGAACCAGTAACAAACTCGATGGGGGCGGTGGGCTTTGCCTAACGTCCCTCGACGC …

Melaleuca lasiandra 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type579 records

Wild obs. + sensor124

Museum / vouchered451

Cultivated / captive2

Other2

Origin

Native52

Range

Area of Occupancy AOO1 576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 101≤10 km 7

108 georeferenced · 16 without coordinates

Open the mapobservation + sensor124

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 82≤1 km 71≤10 km 169>10 km 65

387 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence451

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	117
Kensington, AU	92
Canberra, AU	92
Brisbane, AU	35
Museo Entomologico de Leonlocation not on record	34
Mount Annan, AU	31
Adelaide, AU	27
BGPAlocation not on record	6
Kew, GB	4
John T. Waterhouse Herbariumlocation not on record	3
Armidale, AU	2
Taipei, TW	1
Hobart, AU	1
IPA/SPlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Saint Louis, US	1
Honolulu, US	1

17 institutions · 449 of 451 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)