Melaleuca lanceolata

Otto · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records17 919

Data sources8

Biological traits46

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Melaleuca lanceolata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 919 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources46 traits

Chemical compositionLOTUS · NPASS9 compounds

Occurrence & distributionGBIF17 919 records

DNA & barcodingNCBIsequences

01Narrative

Melaleuca lanceolata est une espèce de plantes à fleurs de la famille des Myrtaceae. C'est un arbuste endémique d'Australie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology18

Fruit length4.5 mm

Fruit width4.5 mm

Leaf length12 mm

Leaf length max15 mm

Leaf length min5 mm

Leaf mass per area305 g/m2

Leaf width2 mm

Leaf width max3 mm

Leaf width min1 mm

Petiole length0.1 cm

Plant height9 m

Plant height max10 m

Plant height min1 m

Seed length1.18 mm

Seed mass0.625 mg

⚠ sources differ — TRY: 0.625 mg · AusTraits: 0.35 mg · GIFT: 0.424 mg

Seed mass max0.625 mg

Seed mass min0.02 mg

Seed width0.43 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typewind

Flowering timeyynnnnnnnnny

Life formshrub or tree

Life spanperennial

Pollination syndromeinsect

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapelinear narrowly_elliptical

Mycorrhiza typeectomycorrhizal

Woodinesswoody

Physiology & chemistry6

Leaf n12.82 mg/g

Leaf p0.598 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)2.79 mm²/mg

Wood density720 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition9 compounds

Compounds documented for Melaleuca lanceolata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aminoacids2

Flavonols2

Gallotannins2

Oleanane triterpenoids1

Lupane triterpenoids1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	LOTUS
2-(3,4-dihydroxyphenyl)-3,5-dihydroxy-7-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	NPASS
3-Methylellagic acid	present	LOTUS
4-Hydroxy-1-methylpyrrolidine-2-carboxylic acid	present	LOTUS
5,7-Dihydroxy-2-(4-Hydroxyphenyl)-3-((2R,3S,4R,5R,6S)-3,4,5-Trihydroxy-6-(Hydroxymethyl)Oxan-2-Yl)Oxychromen-4-One	present	NPASS
Betulinic Acid	present	LOTUS
Ellagic acid	present	LOTUS
n-Methyl-4-hydroxyproline	present	LOTUS
Oleanolic acid	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca lanceolata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF294589.1 ↗277 bp

ACGT

TACATTGTCGAATCCTGCACAGCAGAATGACCAGAGAATAGTAACAAACTCGATGAGGGCGGTGGGCTTTGCCCAACGTCCCTCGACGCT …

Melaleuca lanceolata 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type17 919 records

Wild obs. + sensor15 008

Museum / vouchered2 862

Cultivated / captive36

Other13

Origin

Native12 107

Introduced8

Range

Area of Occupancy AOO31 184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 4 847≤1 km 6 926≤10 km 2 494>10 km 97

14 364 georeferenced · 644 without coordinates

Open the mapobservation + sensor15 008

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 590≤1 km 646≤10 km 1 229>10 km 228

2 693 georeferenced · 169 without coordinates

Open the institutions mapphysical evidence2 862

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy79% within 1 km

≤100 m 5≤1 km 10≤10 km 4

19 georeferenced · 17 without coordinates

Open the mapnot free-living36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	1 343
Canberra, AU	372
Museo Entomologico de Leonlocation not on record	286
Kensington, AU	238
Mount Annan, AU	190
Brisbane, AU	94
Armidale, AU	25
Hobart, AU	15
BGPAlocation not on record	12
Parkville, AU	9
La Trobe Universitylocation not on record	5
Smithfield, AU	5
Kew, GB	4
Canadian Department of Agriculturelocation not on record	4
John T. Waterhouse Herbariumlocation not on record	4
EL PASO, US	3
Taipei, TW	2
Auckland, NZ	2
Tampa, US	2
MAlocation not on record	2
Palmerston, AU	2
Bronx, US	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
University of Stellenboschlocation not on record	1
Miami, US	1
Saint Louis, US	1
Guangzhou, CN	1
JBRJlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
LDlocation not on record	1
Riverside, US	1
Cape Town, ZA	1
Stockholm, SE	1

33 institutions · 2 631 of 2 862 vouchered records shown · 231 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Melaleuca lanceolata

At a glance

Sources8 archives

Size & morphology18

Life cycle & reproduction9

Diet & foraging1

Habitat & environment11

Physiology & chemistry6

Other traits1

Compound class profile5 classes

Documented compounds9 total

At a glance

Record type17 919 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 33 geolocated

Cultivated / Captivenot free-living

Record type17 919 records