Melaleuca hypericifolia

Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records1 245

Data sources8

Biological traits43

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Melaleuca hypericifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 245 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources43 traits

Occurrence & distributionGBIF1 245 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Melaleuca hypericifolia là một loài thực vật có hoa trong Họ Đào kim nương. Loài này được Sm. mô tả khoa học đầu tiên năm 1797.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length6 mm

Fruit width10 mm

Leaf length25 mm

Leaf length max40 mm

Leaf length min10 mm

Leaf width7 mm

Leaf width max10 mm

Leaf width min4 mm

Petiole length0.1 cm

Plant height6 m

⚠ sources differ — AusTraits: 6 m · TRY: 1 m

Plant height max6 m

Plant height min1 m

Seed mass0.141 mg

⚠ sources differ — TRY: 0.141 mg · AusTraits: 0.051 mg · GIFT: 0.136 mg

Seed mass max0.2 mg

Seed mass min0.078 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typewind

Flowering timeyynnnnnnyyyy

Life formshrub or tree

Life spanperennial

Pollination syndromeinsect

Raunkiær life formphanerophyte

Resprouting capacitypartial_resprouting

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate oblong

Woodinesswoody

Physiology & chemistry7

Leaf C:N ratio48.12 g/g

Leaf c500 mg/g

Leaf n10.4 mg/g

Leaf p0.4 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)9.98 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca hypericifolia has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF048873.1 ↗278 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAATGACCAGAGAACCAGTAACAAACTCGATGGGGGCGGTGGGCTTGCCTAACGTCCCCCGACGCT …

Melaleuca hypericifolia 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Melaleuca hypericifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · book-ipcn75-78 · CCDB · book-fedorov

CCDB · book-ipcn75-78 — Brighton

CCDB · book-fedorov — Smith-White 1948a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 245 records

Wild obs. + sensor947

Museum / vouchered281

Cultivated / captive16

Other1

Origin

Native72

Introduced129

Range

Area of Occupancy AOO2 492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 601≤1 km 166≤10 km 36>10 km 11

814 georeferenced · 133 without coordinates

Open the mapobservation + sensor947

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 41≤1 km 68≤10 km 103>10 km 10

222 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence281

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy86% within 1 km

≤100 m 4≤1 km 2≤10 km 1

7 georeferenced · 9 without coordinates

Open the mapnot free-living16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	79
Canberra, AU	55
Museo Entomologico de Leonlocation not on record	37
Adelaide, AU	18
Batemans Bay, AU	11
Armidale, AU	11
Rotorua, NZ	8
Brisbane, AU	7
Tampa, US	7
Auckland, NZ	6
Wollongong, AU	6
Hobart, AU	5
Cape Town, ZA	5
Cape Town, ZA	3
Christchurch, NZ	3
John T. Waterhouse Herbariumlocation not on record	2
Smithfield, AU	2
Riverside, US	1
San Luis Obispo, US	1
Parkville, AU	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Los Angeles, US	1
Kew, GB	1
Cambridge University Herbariumlocation not on record	1
Kensington, AU	1
Valparaiso, CL	1
Universidad de La Salle (La Salle)location not on record	1
LDlocation not on record	1
Santa Barbara, US	1

29 institutions · 277 of 281 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Melaleuca hypericifolia

At a glance

Sources8 archives

Size & morphology15

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry7

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 245 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions23 of 29 geolocated

Cultivated / Captivenot free-living

Record type1 245 records