Melaleuca fulgens

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records128

Data sources8

Biological traits25

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Melaleuca fulgens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility128 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF128 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 44

01Narrative

Melaleuca fulgens là một loài thực vật có hoa trong Họ Đào kim nương. Loài này được R.Br. mô tả khoa học đầu tiên năm 1812.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Plant height1.7 m

Plant height max3 m

Plant height min0.4 m

Seed mass0.16 mg

Seed mass max0.25 mg

Seed mass min0.064 mg

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeself

Flowering timennnnnnyyyyyy

Life formshrub

Life spanperennial

Pollination syndromeinsect

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Melaleuca fulgens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthocyanidins1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Pelargonin		present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca fulgens has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSAF048871.1 ↗278 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAATGACCAGAGAACCAGTAACAAACTCGATGGGGCCGCTAGGCTTGCCTAACGTCCCCCGACGCT …

Melaleuca fulgens PYL1510 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Melaleuca fulgens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 441×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Brighton & Ferguson 1976

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type128 records

Wild obs. + sensor72

Museum / vouchered53

Cultivated / captive3

Origin

Native2

Range

Area of Occupancy AOO328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 13≤1 km 8≤10 km 4>10 km 3

28 georeferenced · 44 without coordinates

Open the mapobservation + sensor72

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 8≤1 km 14≤10 km 6>10 km 3

31 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence53

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 2 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	12
Kensington, AU	7
Kew, GB	6
BGPAlocation not on record	6
Christchurch, NZ	4
Brisbane, AU	3
Canadian Department of Agriculturelocation not on record	2
Cambridge University Herbariumlocation not on record	2
Taipei, TW	1
John T. Waterhouse Herbariumlocation not on record	1
Hobart, AU	1
Mount Annan, AU	1
Claremont, US	1
University of Stellenboschlocation not on record	1
Auckland, NZ	1
Armidale, AU	1
Helsinki, FI	1
Palmerston, AU	1
Canberra, AU	1

19 institutions · 53 of 53 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)