Melaleuca fluviatilis

Barlow · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records700

Data sources8

Biological traits19

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Melaleuca fluviatilis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility700 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources19 traits

Occurrence & distributionGBIF700 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Melaleuca fluviatilis is a plant in the myrtle family, Myrtaceae and is endemic to northern Queensland in Australia. It is a tree with papery bark, narrow leaves and spikes of white or creamy-coloured flowers, usually growing along streams and rivers. It is common in tropical areas and is sometimes confused with Melaleuca argentea although it lacks that species' silvery foliage.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology3

Seed mass0.041 mg

⚠ sources differ — TRY: 0.041 mg · AusTraits: 0.264 mg · GIFT: 0.04 mg

Seed mass max0.04 mg

Seed mass min0.04 mg

Life cycle & reproduction6

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca fluviatilis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH731124.1 ↗577 bpAustralia

ACGT

ATGACCAGAGAACTAGTAACAAACTCGATGAGGGCGGTGGGCTTTGCCCAACGTCCCTCGACGCTTGGATCGCTCGGGCGCCTAGAGCAC …

Melaleuca fluviatilis voucher ThomasMB2318 haplotype single polymorphic internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type700 records

Wild obs. + sensor37

Museum / vouchered500

Cultivated / captive2

Other161

Origin

Native47

Range

Area of Occupancy AOO1 748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 22≤1 km 2≤10 km 1

25 georeferenced · 12 without coordinates

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 129≤1 km 59≤10 km 217>10 km 45

450 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence500

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	222
Canberra, AU	100
Smithfield, AU	39
Museo Entomologico de Leonlocation not on record	37
Mount Annan, AU	29
Palmerston, AU	23
James Cook Townsvillelocation not on record	5
Armidale, AU	4
Hobart, AU	2
Adelaide, AU	2
John T. Waterhouse Herbariumlocation not on record	1
IPA/SPlocation not on record	1
Auckland, NZ	1

13 institutions · 466 of 500 vouchered records shown · 33 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Melaleuca fluviatilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 23.7–23.7

Seasonal swing summer↔winter2.30 °C

Max temp (day)24.2 °C

Min temp (night)23.2 °C

Precipitation64.8 mm/mo

Air humidity60.0 %

Vapour deficit1,167 Pa

Cloud cover31.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)