Melaleuca ericifolia

Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records7 345

Data sources12

Biological traits39

DNA specimens4

eDNA detections3

Sources12 archives

Databases and archives Melaleuca ericifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 345 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources39 traits

Chemical compositionLOTUS · NPASS46 compounds

Occurrence & distributionGBIF7 345 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 22

01Narrative

ملالوكا خلنجية الأوراق هي نوع من النباتات تتبع جنس الملالوكا من الفصيلة الآسيّة.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit width2.75 mm

Leaf length15 mm

Leaf length max15 mm

Leaf length min7 mm

Leaf size14.92 mm²

Leaf width1 mm

Leaf width max1 mm

Petiole length0.1 cm

Plant height7 m

Plant height max8 m

Seed mass0.083 mg

⚠ sources differ — TRY: 0.083 mg · AusTraits: 0.04 mg · GIFT: 0.089 mg

Seed mass max0.23 mg

Seed mass min0.008 mg

Life cycle & reproduction10

Deciduousnessevergreen

Dispersal typewind

Flowering timeyynnnnnnnnny

Life formshrub or tree

Life spanperennial

Lifespan years100 years

⚠ sources differ — TRY: 100 years · AusTraits: 75 years

Pollination syndromeinsect

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub

Leaf compoundnesssimple

Leaf shapelinear

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)8.34 mm²/mg

Wood density613 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition46 compounds

Compounds documented for Melaleuca ericifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Lupane triterpenoids16

Flavonols11

Ursane and Taraxastane triterpenoids7

Gallotannins5

Oleanane triterpenoids4

Documented compounds46 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-beta-Phellandrene	present	NPASS
(+)-Ursolic Acid	present	LOTUS
(1R,3aR,5aR,5bR,7aR,9S,11aR,11bR,13aR,13bR)-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a,9-diol	present	LOTUS
(1R,3aR,5aR,5bR,7aR,9S,11aR,11bR,13aR,13bR)-9-hydroxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylic acid	present	LOTUS
(1R,3aS,5aR,5bR,7aR,9S,11aR,11bR,13aR,13bR)-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a,9-diol	present	LOTUS
(1R,3aS,5aR,5bR,7aR,9S,11aR,11bR,13aR,13bS)-9-hydroxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carbaldehyde	present	LOTUS
(1R,3aS,5aR,5bR,7aS,9S,11aR,11bR,13aR,13bR)-1-acetyl-9-hydroxy-5a,5b,8,8,11a-pentamethyl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylic acid	present	LOTUS
(1S,4R,5R,8R,10S,13R,14R,17R,18R,19S,20R)-4,5,9,9,13,20-hexamethyl-22-oxahexacyclo[17.3.2.01,18.04,17.05,14.08,13]tetracosan-10-ol	present	LOTUS
1,6-di-O-Galloylglucose	present	LOTUS
1-Acetyl-9-hydroxy-5a,5b,8,8,11a-pentamethyl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylic acid	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca ericifolia has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences1

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF048870.1 ↗282 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAACGACCAGAGAACCAGTAACAAACTCGACGGGGGCGGTGGGCTTGCCCAACGCCCCTCGACGCT …

Melaleuca ericifolia 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Melaleuca ericifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-fedorov

CCDB · book-fedorov — Smith-White 1948a

n 111×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Vijayakumar, N. & D. Subramanian. 1985. Cytotaxonomical studies in south Indian Myrtaceae. Cytologia 50: 513–520.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type7 345 records

Wild obs. + sensor6 607

Museum / vouchered735

Cultivated / captive3

Origin

Native142

Introduced2

Range

Area of Occupancy AOO13 352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 4 140≤1 km 1 893≤10 km 294>10 km 38

6 365 georeferenced · 242 without coordinates

Open the mapobservation + sensor6 607

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 37≤1 km 221≤10 km 329>10 km 71

658 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence735

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 2 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	173
Hobart, AU	153
Mount Annan, AU	138
Canberra, AU	118
Adelaide, AU	31
Armidale, AU	16
Parkville, AU	13
Batemans Bay, AU	11
Brisbane, AU	11
QVMAGlocation not on record	10
NSW Dept of Planning, Industry and Environmentlocation not on record	9
La Trobe Universitylocation not on record	8
Wollongong, AU	6
Auckland, NZ	4
Smithfield, AU	4
Tampa, US	3
Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record	3
Cape Town, ZA	2
Wellington, NZ	2
Kensington, AU	2
Christchurch, NZ	1
Vitoria, ES	1
Palmerston, AU	1
John T. Waterhouse Herbariumlocation not on record	1
San Luis Obispo, US	1
Canadian Department of Agriculturelocation not on record	1
Kew, GB	1
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1
Santa Barbara, US	1
Cape Town, ZA	1
Durban, ZA	1

31 institutions · 728 of 735 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Melaleuca ericifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 12.7–16.6

Seasonal swing summer↔winter8.40 °C

Max temp (day)18.4 °C 16.5–20.3

Min temp (night)10.2 °C 9.00–12.7

Precipitation124 mm/mo 101–180

Air humidity60.9 % 58.6–61.0

Moisture balance-33.9 mm/mo -35.7–104

Vapour deficit636 Pa 572–784

Wind speed3.50 m/s 2.60–4.10

Cloud cover12.4 % 9.70–17.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Melaleuca ericifolia

At a glance

Sources12 archives

Size & morphology13

Life cycle & reproduction10

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

Other traits1

Compound class profile5 classes

Documented compounds46 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type7 345 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions23 of 31 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 345 records