Melaleuca diosmifolia

Andrews · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records171

Data sources10

Biological traits32

DNA specimens4

eDNA detections4

Sources10 archives

Databases and archives Melaleuca diosmifolia's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility171 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources32 traits

Occurrence & distributionGBIF171 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Habit on Mount Melville in Albany Melaleuca diosmifolia is a plant in the myrtle family, Myrtaceae and is endemic to the south-west of Western Australia. It has also become naturalised in Victoria (Australia) Australia. It is unusual for its genus in that the flowers are green, which partly accounts for its popularity as a garden plant. It is only distantly related to Melaleuca diosmatifolia although its species name has a similar etymology.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Fruit length6.5 mm

Fruit width10.5 mm

Leaf length9.5 mm

Leaf width4 mm

Petiole length0.15 cm

Plant height3 m

Plant height max3 m

Plant height min1 m

Seed mass0.071 mg

⚠ sources differ — TRY: 0.071 mg · AusTraits: 0.074 mg · GIFT: 0.07 mg

Seed mass max0.07 mg

Seed mass min0.07 mg

Life cycle & reproduction8

Deciduousnessevergreen

Flowering timennnnnnnnyynn

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Reproductive maturity7 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical narrowly_ovate ovate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca diosmifolia has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences6

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSAF048869.1 ↗277 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAATGACCAGAGAACTAGTAACAAACTCGATGGGGGCGGTGGGCTTGCCTAACGTCCCCTGACGCT …

Melaleuca diosmifolia 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Melaleuca diosmifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Brighton & Ferguson 1976

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type171 records

Wild obs. + sensor77

Museum / vouchered89

Cultivated / captive5

Origin

Native7

Introduced34

Range

Area of Occupancy AOO428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 58≤1 km 8≤10 km 4>10 km 1

71 georeferenced · 6 without coordinates

Open the mapobservation + sensor77

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 17≤1 km 11≤10 km 31>10 km 2

61 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence89

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 4 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	29
Rotorua, NZ	11
Canberra, AU	10
Museo Entomologico de Leonlocation not on record	9
Mount Annan, AU	7
Adelaide, AU	4
Cape Town, ZA	3
Riverside, US	2
Wellington, NZ	2
Auckland, NZ	2
BGPAlocation not on record	2
MAlocation not on record	1
Brisbane, AU	1
Hobart, AU	1
Kew, GB	1
Armidale, AU	1
Christchurch, NZ	1
Smithfield, AU	1
Helsinki, FI	1

19 institutions · 89 of 89 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Melaleuca diosmifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)