Melaleuca deanei

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records586

Data sources8

Biological traits35

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Melaleuca deanei's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility586 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF586 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Melaleuca deanei, commonly known as Deane's paperbark, is a plant in the myrtle family, Myrtaceae and is endemic to New South Wales in Australia. It is a shrub with flaky bark, narrow oval leaves and spikes of white flowers in spring and summer. The species only exists in a few isolated populations and is classified as vulnerable.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Fruit width6.25 mm

Leaf length18.5 mm

Leaf length max2.5 mm

Leaf width4.5 mm

Leaf width max25 mm

Leaf width min12 mm

Petiole length0.25 cm

Plant height3 m

Seed mass0.33 mg

Seed mass max0.33 mg

Seed mass min0.33 mg

Life cycle & reproduction11

Deciduousnessevergreen

Dispersal typeself

Flowering timennnnnnnnyyyn

Life formshrub or tree

Life span>100

⚠ sources differ — TRY: >100 · AusTraits: perennial · GIFT: perennial

Lifespan years100 years

Pollination syndromebird+insect+mammal

Raunkiær life formphanerophyte

Reproductive maturity5 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical oblanceolate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca deanei has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSEF041513.1 ↗697 bp

ACGT

CACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCACAG …

Melaleuca deanei 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type586 records

Wild obs. + sensor371

Museum / vouchered206

Cultivated / captive9

Origin

Native110

Range

Area of Occupancy AOO736 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 328≤1 km 23≤10 km 9>10 km 6

366 georeferenced · 5 without coordinates

Open the mapobservation + sensor371

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 28≤1 km 41≤10 km 50>10 km 10

129 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence206

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy80% within 1 km

≤100 m 4≤10 km 1

5 georeferenced · 4 without coordinates

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	109
NSW Dept of Planning, Industry and Environmentlocation not on record	39
Canberra, AU	19
Museo Entomologico de Leonlocation not on record	11
Brisbane, AU	8
Wollongong, AU	5
Armidale, AU	4
Hobart, AU	2
Kew, GB	2
Smithfield, AU	2
Auckland, NZ	1
University of Stellenboschlocation not on record	1
Adelaide, AU	1

13 institutions · 204 of 206 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Melaleuca deanei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)