Melaleuca dealbata

S.T.Blake · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records1 194

Data sources10

Biological traits34

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Melaleuca dealbata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 194 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Occurrence & distributionGBIF1 194 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Melaleuca dealbata, commonly known as karnbor or blue paperbark, is a plant in the myrtle family, Myrtaceae and is native to tropical areas in northern Australia, New Guinea and Indonesia. It is a medium to large leafy tree, growing in wet areas such as on the edges of coastal lagoons. It has papery bark, relatively large, blue-green leaves and spikes of cream-coloured flowers over a long period.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit length3.75 mm

Fruit width3.75 mm

Leaf length90 mm

Leaf width21 mm

Petiole length0.65 cm

Plant height15 m

Plant height max15 m

Plant height min6 m

Seed length1 mm

Seed mass0.204 mg

⚠ sources differ — TRY: 0.204 mg · AusTraits: 0.217 mg · GIFT: 0.2 mg

Seed mass max0.36 mg

Seed mass min0.024 mg

Seed width1 mm

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timennnnnnnyyyyn

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca dealbata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH731099.1 ↗574 bpAustralia

ACGT

ATGACCAGAGAACTAGTAACAAACTCGATGAGGGCGGTGGGCTTTGCCCAACGTCCCTCGACGCTTGGATCGCTCGGGCGCCTAGAGCGC …

Melaleuca dealbata voucher Bean23877_short haplotype short length polymorphism internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Melaleuca dealbata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Oginuma, K., S. K. Y. Lum, Y. H. Lee & H. Tobe. 1992. Karyomorphology of some Myrtaceae from Singapore. Gard. Bull. Singapore 44: 135–139.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 194 records

Wild obs. + sensor360

Museum / vouchered620

Cultivated / captive1

Other213

Origin

Native57

Range

Area of Occupancy AOO2 836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 219≤1 km 17≤10 km 2>10 km 3

241 georeferenced · 119 without coordinates

Open the mapobservation + sensor360

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 75≤1 km 84≤10 km 273>10 km 64

496 georeferenced · 124 without coordinates

Open the institutions mapphysical evidence620

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	163
Brisbane, AU	153
Palmerston, AU	70
Smithfield, AU	50
Museo Entomologico de Leonlocation not on record	36
Kensington, AU	31
Mount Annan, AU	30
Adelaide, AU	9
Kew, GB	8
James Cook Townsvillelocation not on record	5
Honolulu, US	5
Armidale, AU	4
BISHlocation not on record	4
John T. Waterhouse Herbariumlocation not on record	3
University of Stellenboschlocation not on record	2
Taipei, TW	1
IPA/SPlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1

18 institutions · 576 of 620 vouchered records shown · 42 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Melaleuca dealbata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 24.4–25.4

Seasonal swing summer↔winter2.20 °C

Max temp (day)25.4 °C 24.9–25.9

Min temp (night)24.4 °C 24.0–24.8

Precipitation199 mm/mo 118–280

Air humidity62.1 % 61.1–63.1

Vapour deficit1,190 Pa 1,188–1,192

Cloud cover40.1 % 35.2–45.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Melaleuca dealbata

At a glance

Sources10 archives

Size & morphology13

Life cycle & reproduction7

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 194 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 194 records