Melaleuca capitata

Cheel · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records325

Data sources6

Biological traits34

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Melaleuca capitata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility325 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Occurrence & distributionGBIF325 records

DNA & barcodingNCBIsequences

01Narrative

Melaleuca capitata is a shrub in the myrtle family, Myrtaceae and is endemic to New South Wales. It has scaly bark, a densely foliaged habit and attractive heads of creamy-yellow flowers on the ends of its branches in summer.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology14

Fruit length5.5 mm

Fruit width3.5 mm

Leaf length17.5 mm

Leaf length max25 mm

Leaf length min10 mm

Leaf width2 mm

Leaf width max3 mm

Leaf width min1 mm

Petiole length0.225 cm

Plant height2 m

Plant height max2 m

Seed mass0.31 mg

Seed mass max0.56 mg

Seed mass min0.052 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timeyynnnnnnnnny

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca capitata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF048868.1 ↗282 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAATGACCAGAGAACTAGTAACAAACTCAATGGGGGCGGTGGGCTTTCGCGCCCAACGTCCCTAGG …

Melaleuca capitata 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type325 records

Wild obs. + sensor145

Museum / vouchered172

Cultivated / captive8

Origin

Native59

Range

Area of Occupancy AOO480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 105≤1 km 12≤10 km 3>10 km 1

121 georeferenced · 24 without coordinates

Open the mapobservation + sensor145

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 22≤1 km 51≤10 km 79>10 km 8

160 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence172

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 4

7 georeferenced · 1 without coordinates

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	59
Canberra, AU	56
Museo Entomologico de Leonlocation not on record	14
Wollongong, AU	8
Brisbane, AU	7
NSW Dept of Planning, Industry and Environmentlocation not on record	5
Batemans Bay, AU	5
Kew, GB	4
Adelaide, AU	3
Armidale, AU	2
Auckland, NZ	2
John T. Waterhouse Herbariumlocation not on record	1
Hobart, AU	1
Smithfield, AU	1

14 institutions · 168 of 172 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)