Melaleuca bracteata

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records2 672

Data sources11

Biological traits45

DNA specimens14

eDNA detections11

Sources11 archives

Databases and archives Melaleuca bracteata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 672 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources45 traits

Chemical compositionDukesPhytochem · LOTUS11 compounds

Occurrence & distributionGBIF2 672 records

Environmental DNA1 datasets · 3 countries11 detections

DNA & barcodingBOLD · NCBI14 specimens

01Narrative

Melaleuca bracteata, commonly known as the black tea-tree, river tea-tree or mock olive is a plant in the myrtle family, Myrtaceae and is endemic to northern Australia. It usually occurs as a large shrub but under ideal conditions can grow into a tree up to 10 m tall. It is an adaptable species in cultivation and a number of cultivars have been developed.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology19

Fruit length2.5 mm

Fruit width2.5 mm

Leaf length10 mm

Leaf length max28 mm

Leaf length min10 mm

Leaf mass2.63 mg

Leaf mass per area65.57 g/m2

Leaf size24.18 mm²

⚠ sources differ — TRY: 24.18 mm² · AusTraits: 40.13 mm²

Leaf width2 mm

Leaf width max3 mm

Leaf width min1.5 mm

Plant height8 m

⚠ sources differ — GIFT: 8 m · AusTraits: 6 m

Plant height max15 m

Plant height min1 m

Seed length1 mm

Seed mass0.049 mg

⚠ sources differ — TRY: 0.049 mg · AusTraits: 0.049 mg · GIFT: 0.045 mg

Seed mass max0.058 mg

Seed mass min0.037 mg

Seed width1 mm

Life cycle & reproduction10

Deciduousnessevergreen

Dispersal typeself

Flowering timeyynnyyyyyyyy

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapenarrowly_ovate ovate

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)9.8 mm²/mg

Wood density870 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition11 compounds

Compounds documented for Melaleuca bracteata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cinnamic acids and derivatives2

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
EO	10,000 ppm	DukesPhytochem
METHYL-EUGENOL	9,000 ppm	DukesPhytochem
ALPHA-PHELLANDRENE	500 ppm	DukesPhytochem
CINNAMIC-ACID-ESTERS	100 ppm	DukesPhytochem
CINNAMYL-CINNAMATE	100 ppm	DukesPhytochem
CINNAMIC-ACID	100 ppm	DukesPhytochem
CINNAMYL-ALCOHOL	100 ppm	DukesPhytochem

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca bracteata has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes4

GenBank sequences7

eDNA detections11

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMW139118.1 ↗315 bp

ACGT

CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGTTAGGGCACGTTTGCCTGGGTGTCACACATGGCGTTGCCCCT …

Melaleuca bracteata isolate Mel-bra-N-seq3 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL2★rbcLa★ITS5

plant barcodefungal barcode

08Occurrence & distribution

Record type2 672 records

Wild obs. + sensor1 140

Museum / vouchered1 095

Cultivated / captive5

Other432

Origin

Native160

Introduced262

Range

Area of Occupancy AOO6 420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 795≤1 km 59≤10 km 20>10 km 20

894 georeferenced · 246 without coordinates

Open the mapobservation + sensor1 140

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 174≤1 km 157≤10 km 425>10 km 175

931 georeferenced · 164 without coordinates

Open the institutions mapphysical evidence1 095

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 3 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	259
Canberra, AU	185
Mount Annan, AU	140
Palmerston, AU	123
Museo Entomologico de Leonlocation not on record	89
Adelaide, AU	71
Kensington, AU	57
Smithfield, AU	50
Armidale, AU	30
James Cook Townsvillelocation not on record	18
Kew, GB	14
Rotorua, NZ	8
BGPAlocation not on record	4
Stockholm, SE	3
Hobart, AU	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Canadian Department of Agriculturelocation not on record	2
Cape Town, ZA	2
Bronx, US	2
John T. Waterhouse Herbariumlocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Wollongong, AU	1
Taipei, TW	1
Wellington, NZ	1
Durban, ZA	1
Riverside, US	1
Honolulu, US	1
Herbarium of South China Botanical Gardenlocation not on record	1
MeiseBGlocation not on record	1
AUAlocation not on record	1
Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record	1
Northridge, US	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Parkville, AU	1

34 institutions · 1 076 of 1 095 vouchered records shown · 19 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA11 detections

Where the DNA of Melaleuca bracteata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 16.5–19.7

Seasonal swing summer↔winter10.8 °C

Max temp (day)24.6 °C 19.7–24.8

Min temp (night)14.0 °C 12.3–15.0

Precipitation98.9 mm/mo 85.9–322

Air humidity58.7 % 57.3–68.0

Moisture balance-30.5 mm/mo -72.3–221

Vapour deficit959 Pa 615–972

Wind speed3.40 m/s 2.40–3.60

Cloud cover24.8 % 12.1–48.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Melaleuca bracteata

At a glance

Sources11 archives

Size & morphology19

Life cycle & reproduction10

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

Other traits1

Compound class profile1 class

Documented compounds11 total

At a glance

Record type2 672 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 34 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 672 records