Melaleuca alsophila

A.Cunn. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records226

Data sources8

Biological traits23

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Melaleuca alsophila's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility226 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Occurrence & distributionGBIF226 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Melaleuca alsophila, commonly known as the saltwater paperbark, is a plant in the myrtle family, Myrtaceae and is endemic to the north of Western Australia. It is a dense shrub or small tree with fibrous or papery bark and is common in areas seasonally inundated during the wet season.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Plant height8.5 m

Plant height max15 m

Plant height min2 m

Seed mass0.111 mg

Seed mass max0.11 mg

Seed mass min0.11 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timennyyyyyyyynn

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub tree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca alsophila has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH731154.1 ↗580 bpAustralia

ACGT

ATGACCAGAGAACCAGTAACAATCCGATGGGGGCGGTGGGCTTTGCCCAACGTCCCTTTGACGCCTTGGATCGCACGGGCGCCTAAGAGC …

Melaleuca alsophila voucher RDE309 haplotype single polymorphic internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type226 records

Wild obs. + sensor13

Museum / vouchered213

Origin

Native20

Range

Area of Occupancy AOO600 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 11≤10 km 1

12 georeferenced · 1 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 25≤1 km 17≤10 km 106>10 km 27

175 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence213

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	83
Canberra, AU	56
Museo Entomologico de Leonlocation not on record	22
Palmerston, AU	19
Brisbane, AU	15
BGPAlocation not on record	4
Mount Annan, AU	3
Adelaide, AU	3
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Saint Louis, US	1

10 institutions · 207 of 213 vouchered records shown · 5 without an institution code

09Environmental DNA2 detections

Where the DNA of Melaleuca alsophila was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.7 °C 26.9–28.5

Seasonal swing summer↔winter8.40 °C

Max temp (day)33.3 °C 32.3–34.4

Min temp (night)22.4 °C 21.9–22.9

Precipitation75.3 mm/mo 73.7–77.0

Air humidity48.9 %

Moisture balance-100 mm/mo -110–-90.4

Vapour deficit1,898 Pa 1,806–1,991

Wind speed3.40 m/s 2.60–4.30

Cloud cover35.5 % 35.3–35.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)