Megaptera novaeangliae

(Borowski, 1781) · species

image placeholder — illustration coming later

Animalia/Chordata/Mammalia/Cetacea/Balaenopteridae/Megaptera

At a glance

Occurrence records993 921

Data sources13

Biological traits0

DNA specimens41

eDNA detections932

Sources13 archives

Databases and archives Megaptera novaeangliae's data was compiled from.

WikipediaWikimedia Foundation20 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility494 806 records↗

OBISOcean Biodiversity Information System499 089 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI932 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Occurrence & distributionGBIF · OBIS · PBDB993 921 records

Environmental DNA8 datasets · 5 countries932 detections

DNA & barcodingBOLD41 specimens

Genome at a glanceGoaT · NCBI≈3.1 Gbp

Deep timePBDB26 fossils

01Narrative

The humpback whale (Megaptera novaeangliae) is a species of baleen whale. It is a rorqual; a member of the family Balaenopteridae. Adults range in length from 14 - and weigh up to 40 metric ton. The humpback has a distinctive body shape, with long pectoral fins and a knobbly head. It is known for breaching and other distinctive surface behaviors, making it popular with whale watchers. Males produce a complex song typically lasting 4 to 33 minutes. Found in oceans and seas around the world, humpback whales typically migrate up to 16000 km each year. They feed in polar waters and migrate to tropical or subtropical waters to breed and give birth. Their diet consists mostly of krill and small fish. Unique among large whales, humpbacks use bubbles to catch prey. They are promiscuous breeders, with both sexes having multiple partners. Orcas are the main natural predators of humpback whales. Like other large whales, the humpback was a target for the whaling industry. Humans once hunted the species to the brink of extinction; its population fell to around 5,000 by the 1960s. While numbers have partially recovered to some 135,000 animals worldwide, entanglement in fishing gear, collisions with ships, and noise pollution continue to affect the species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Megaptera novaeangliae has left across the world's sequence archives.

At a glance

DNA specimens41

BINs1

Marker genes11

eDNA detections932

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

3Cmostly conserved

225Cvariable

273Tvariable

375Tvariable

387Tmostly conserved

ACCCTATATTTATTATTTGGTGCCTGAGCAGGAATAGTAGGCACTGGCCTAAGCTTATTAATTCGCGCTGAGCTAGGTCAGCCTGGCACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.28%

Haplotypes7

BIN1

Most divergent pair0.76%

N.AmericaS.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Balaenoptera physalussame family5.6%Balaenoptera bonaerensissame family6.6%Balaenoptera edenisame family6.7%Balaenoptera musculussame family6.8%Balaenoptera borealissame family7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_006927 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Megaptera novaeangliae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈3 146 604 256 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Megaptera novaeangliae3.15 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

07Deep time23–0 Ma

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

Fossil range23–0 Ma Oligocene → Holocene

Dated fossil finds26

Most finds around0.25 Ma 24 finds · Pleistocene

StatusStill living record runs to the present

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Megaptera novaeangliae. Above itBeside it, the bars count how many dated finds fall in each slice of time; the tallest bar is labelled, and heights use a square-root scale so that thin slices stay visible next to rich ones. Read this as how well each stretch of time is preserved and studied — thick bars mean plenty of the right kind of rock and plenty of collectors, which is related to, but not the same as, how common it actually was.

fossil range (PBDB)dated finds per slice

How it livedPBDB

Environmentmarine

Life habitaquatic

Dietsuspension feeder

Motilityactively mobile

Compositionhydroxyapatite

Reproductionviviparous

Ontogenymodification of parts

08Occurrence & distribution

Record type993 921 records

Wild obs. + sensor990 704

Museum / vouchered1 401

Fossil26

Other1 790

Origin

Native178

Range

Area of Occupancy AOO460 816 km²

Depth

0–200 m sunlit43 109

200–1000 m twilight1

1–4 km midnight10

>4 km abyssal0

median 0 m · max 2 409.4 m · 43 120 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 381 572≤1 km 14 742≤10 km 55 218>10 km 371 446

822 978 georeferenced · 167 726 without coordinates

Open the mapobservation + sensor990 704

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 396≤1 km 89≤10 km 382>10 km 13

880 georeferenced · 521 without coordinates

Open the institutions mapphysical evidence1 401

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	111
Washington, US	110
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	37
Edmonton, CA	32
Natick, US	31
Sydney, AU	31
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	27
Stockholm, SE	26
CASlocation not on record	22
Cambridge, US	8
Berkeley, US	7
Los Angeles, US	5
NSW Dept of Planning, Industry and Environmentlocation not on record	5
Western Australian Museumlocation not on record	4
Ciudad de México, MX	4
North Carolina Museum of Natural Scienceslocation not on record	4
Tasmanian Museum & Art Gallerylocation not on record	3
East Lansing, US	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
San Diego, US	2
Bergen, NO	2
University of Georgia Museum of Natural Historylocation not on record	2
Buenos Aires, AR	2
Natural History Museum Rotterdamlocation not on record	2
Tromsø, NO	1
Mexico City, MX	1
Albany, US	1
NTNU-VMlocation not on record	1
MHNBlocation not on record	1
Liverpool, GB	1
	1
South Kensington, GB	1
Centro de Investigacion Cientifica y de Educacion Superior de Ensenadalocation not on record	1
Chicago, US	1
Museo de Historia Natural, Universidad Autónoma de Baja California Surlocation not on record	1
Saint John, CA	1
Auckland, NZ	1
Copenhagen, DK	1
Seattle, US	1

39 institutions · 498 of 1 401 vouchered records shown · 417 without an institution code

09Environmental DNA932 detections

Where the DNA of Megaptera novaeangliae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found932

Studies independent surveys8

Countries5

Verifiable raw sequence linked659

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 932 detections have coordinates

Open the map5 countries0

Pacific Ocean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 12.5–17.9

Seasonal swing summer↔winter20.6 °C

Max temp (day)18.2 °C 13.9–19.2

Min temp (night)16.2 °C 11.0–16.9

Precipitation103 mm/mo 94.9–134

Air humidity67.7 % 61.3–73.3

Vapour deficit611 Pa 478–683

Cloud cover46.6 % 39.2–51.6

CHELSA 1981–2010, ~9 km grid, at location & month of 925 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Megaptera novaeangliae

At a glance

Sources13 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

How it livedPBDB

Record type993 921 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions24 of 39 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type993 921 records