Megachile rubi

Mitchell, 1924 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Megachile

At a glance

Occurrence records119

Data sources6

Biological traits0

DNA specimens3

eDNA detections0

Sources6 archives

Databases and archives Megachile rubi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility119 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF119 records

DNA & barcodingBOLD3 specimens

01Narrative

Megachile rubi is a species of leaf cutting bee in the family Megachilidae, found in the eastern United States. First described by Mitchell in 1924, it is placed in the subgenus Xeromegachile, members of which are most often found in sandy areas and have distinct preferences in the petals and leaves they use in their nests.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Megachile rubi has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.41%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 4 variable positions, in barcode order

85Tvariable

340Tvariable

361Avariable

439Gvariable

AATATTATACATAATTTTTGCCTTATGAGCAGGTATAATCGGATCAAGATTATCAATAATTATTCGAATAGAATTAAGAATTCCTGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megachile xerophilasame genus7.4%Megachile sublauritasame genus7.6%Megachile casadaesame genus7.8%Megachile nevadensissame genus7.9%Megachile wheelerisame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type119 records

Museum / vouchered119

Range

Area of Occupancy AOO136 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 3

6 georeferenced · 113 without coordinates

Open the institutions mapphysical evidence119

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
	60
US	18
Cornell University Insect Collectionlocation not on record	16
Beltsville, US	12
North Carolina State University Insect Museumlocation not on record	3
Lexington, US	2
Champaign, US	2
Mississippi State, US	1
Cambridge, US	1
CUlocation not on record	1
Wuzhou, CN	1
Washington, US	1

12 institutions · 118 of 119 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)