Megachile pyrenaica

Lepeletier, 1841 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Megachile

At a glance

Occurrence records1 602

Data sources7

Biological traits0

DNA specimens14

eDNA detections9

Sources7 archives

Databases and archives Megachile pyrenaica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 602 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 602 records

Environmental DNA1 datasets · 3 countries9 detections

DNA & barcodingBOLD14 specimens

01Narrative

Megachile pyrenaica is a species of bee in the family Megachilidae. It was described by Amédée Louis Michel Lepeletier in 1841.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Megachile pyrenaica has left across the world's sequence archives.

At a glance

DNA specimens14

BINs3

Marker genes1

eDNA detections9

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 90 variable positions, in barcode order

22Cmostly conserved

23Amostly conserved

43Amostly conserved

46Amostly conserved

47Tmostly conserved

55Tmostly conserved

64Cmostly conserved

67Amostly conserved

79Amostly conserved

81Cmostly conserved

85Tmostly conserved

89Tmostly conserved

97Cmostly conserved

106Tmostly conserved

127Amostly conserved

133Tmostly conserved

136Cmostly conserved

139Amostly conserved

142Tmostly conserved

158Tmostly conserved

163Amostly conserved

166Amostly conserved

169Amostly conserved

181Tmostly conserved

184Amostly conserved

193Tmostly conserved

205Cmostly conserved

208Tmostly conserved

214Cvariable

217Gmostly conserved

220Amostly conserved

232Cmostly conserved

235Tmostly conserved

241Tmostly conserved

250Cvariable

268Gvariable

271Amostly conserved

274Amostly conserved

284Tmostly conserved

287Tmostly conserved

290Tmostly conserved

310Cvariable

316Tmostly conserved

325Amostly conserved

328Amostly conserved

335Amostly conserved

337Tmostly conserved

340Tmostly conserved

347Tmostly conserved

367Tmostly conserved

368Cmostly conserved

373Amostly conserved

376Cvariable

394Tmostly conserved

406Cmostly conserved

433Amostly conserved

437Cmostly conserved

454Amostly conserved

457Cmostly conserved

478Cmostly conserved

489Gmostly conserved

490Amostly conserved

499Cmostly conserved

506Tmostly conserved

508Cmostly conserved

514Amostly conserved

518Tmostly conserved

520Tmostly conserved

532Amostly conserved

539Cmostly conserved

542Tmostly conserved

547Gvariable

548Cmostly conserved

550Amostly conserved

553Amostly conserved

562Cmostly conserved

571Cmostly conserved

574Tmostly conserved

578Cmostly conserved

580Tmostly conserved

581Cmostly conserved

601Tmostly conserved

616Cmostly conserved

619Tmostly conserved

625Amostly conserved

628Amostly conserved

634Cmostly conserved

643Amostly conserved

646Tmostly conserved

652Tmostly conserved

AATAATATATATAATTTTTGCCATATGATCAGGAATAATTGGATCATCAATAAGTATAATTATCCGAATAGAATTAAGAACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.7%

Haplotypes7

BINs3

Most divergent pair11.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megachile newberryaesame genus10.8%Megachile albonotatasame genus10.8%Megachile rufescenssame genus10.9%Megachile subnigrasame genus11.6%Megachile fidelissame genus11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 602 records

Wild obs. + sensor336

Museum / vouchered1 208

Other58

Origin

Native602

Range

Area of Occupancy AOO1 708 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy35% within 1 km

≤100 m 56≤1 km 34≤10 km 165>10 km 1

256 georeferenced · 80 without coordinates

Open the mapobservation + sensor336

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤100 m 2≤1 km 20≤10 km 1 108>10 km 37

1 167 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence1 208

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bern, CH	215
Musee d'Histoire Naturallelocation not on record	135
Zürich, CH	132
Paro, BT	85
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	66
Geneva, CH	31
Coimbra, PT	30
Museum zu Allerheiligen Schaffhausenlocation not on record	29
Dhaka, BD	22
Sion, CH	15
	14
PRUNlocation not on record	8
ZSMlocation not on record	8
Beltsville, US	6
PRAZlocation not on record	4
IENElocation not on record	4
Archäologie und Museum Baselland - Museum.BLlocation not on record	4
Philadelphia, US	3
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
University of Florence, Department of Biologylocation not on record	2
Bonn, DE	1

21 institutions · 816 of 1 208 vouchered records shown · 392 without an institution code

09Environmental DNA9 detections

Where the DNA of Megachile pyrenaica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 14.0–16.1

Seasonal swing summer↔winter20.3 °C

Max temp (day)18.8 °C 17.9–19.5

Min temp (night)9.50 °C 8.20–10.8

Precipitation82.7 mm/mo 73.7–92.1

Air humidity58.0 % 57.9–58.7

Moisture balance-37.4 mm/mo -74.6–-32.6

Vapour deficit711 Pa 673–775

Wind speed2.30 m/s 1.80–2.60

Cloud cover36.3 % 36.2–37.7

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Megachile pyrenaica

At a glance

Sources7 archives

At a glance

Record type1 602 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 602 records