Megachile pseudobrevis

Mitchell, 1935 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Megachile

At a glance

Occurrence records269

Data sources6

Biological traits0

DNA specimens6

eDNA detections9

Sources6 archives

Databases and archives Megachile pseudobrevis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility269 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF269 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD6 specimens

01Narrative

Megachile pseudobrevis, the southeastern little leaf-cutter bee, is a species of hymenopteran in the family Megachilidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Megachile pseudobrevis has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.05%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

220Amostly conserved

AATATTATATATAATTTTTGCTTTATGATCAGGAATAATTGGATCTAGATTATCTATAATCATTCGAATAGAATTAAGAATCCCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megachile onobrychidissame genus2.1%Megachile brevissame genus5.5%Megachile lippiaesame genus6.4%Megachile texanasame genus6.4%Megachile cleomissame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type269 records

Wild obs. + sensor1

Museum / vouchered266

Other2

Range

Area of Occupancy AOO460 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 6>10 km 2

8 georeferenced · 258 without coordinates

Open the institutions mapphysical evidence266

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	116
Wuzhou, CN	44
	33
Cornell University Insect Collectionlocation not on record	31
Mississippi State, US	14
WIlocation not on record	10
Cambridge, US	9
Montgomery, US	4
College Station, US	1
North Carolina State University Insect Museumlocation not on record	1

10 institutions · 263 of 266 vouchered records shown · 3 without an institution code

09Environmental DNA9 detections

Where the DNA of Megachile pseudobrevis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.3 °C 18.7–27.0

Seasonal swing summer↔winter15.4 °C

Max temp (day)25.6 °C 21.1–31.4

Min temp (night)18.6 °C 14.9–25.1

Precipitation114 mm/mo 69.2–216

Air humidity59.8 % 57.9–63.8

Moisture balance-27.1 mm/mo -97.8–45.4

Vapour deficit1,101 Pa 890–1,328

Wind speed2.90 m/s 2.00–4.90

Cloud cover33.9 % 28.2–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)