Megachile pruina

Smith, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Megachile

At a glance

Occurrence records463

Data sources7

Biological traits0

DNA specimens14

eDNA detections14

Sources7 archives

Databases and archives Megachile pruina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility463 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF463 records

Environmental DNA1 datasets · 1 countries14 detections

DNA & barcodingBOLD14 specimens

01Narrative

Female M. pruina Megachile pruina, also known as the Hoary Leafcutter Bee, is a species of bee in the family Megachilidae. It was described by Smith in 1853.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Megachile pruina has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections14

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P647 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

23Amostly conserved

29Cmostly conserved

209Avariable

240Amostly conserved

302Avariable

336Tvariable

374Cvariable

377Gvariable

503Tmostly conserved

TAATTTTTGCTATATGATCAGGAATAATCGGATCAAGATTATCAATAATTATTCGTATAGAATTAAGAACACCAGGTTCATGAATTAAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes4

BIN1

Most divergent pair1.1%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megachile luctiferasame genus7.6%Megachile vitracisame genus8.7%Megachile diligenssame genus9.1%Megachile casadaesame genus9.9%Megachile melanogastersame genus10.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type463 records

Wild obs. + sensor274

Museum / vouchered189

Range

Area of Occupancy AOO976 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 139≤1 km 53≤10 km 8>10 km 36

236 georeferenced · 38 without coordinates

Open the mapobservation + sensor274

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤100 m 1≤10 km 15>10 km 8

24 georeferenced · 165 without coordinates

Open the institutions mapphysical evidence189

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	83
Wuzhou, CN	20
Cambridge, US	20
	15
Beltsville, US	13
Cornell University Insect Collectionlocation not on record	12
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	12
Lake Placid, US	9
WIlocation not on record	2
Mississippi State, US	1
Montgomery, US	1
University of Central Floridalocation not on record	1

12 institutions · 189 of 189 vouchered records shown

09Environmental DNA14 detections

Where the DNA of Megachile pruina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.3 °C 21.0–26.8

Seasonal swing summer↔winter14.3 °C

Max temp (day)25.6 °C 24.4–28.3

Min temp (night)23.1 °C 18.7–25.4

Precipitation74.0 mm/mo 61.8–106

Air humidity61.4 % 59.0–65.0

Moisture balance-93.0 mm/mo -126–-73.3

Vapour deficit1,133 Pa 1,007–1,265

Wind speed4.40 m/s 2.70–4.80

Cloud cover34.1 % 28.1–38.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)