Megachile prosopidis

Cockerell, 1900 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Megachile

At a glance

Occurrence records853

Data sources7

Biological traits1

DNA specimens11

eDNA detections23

Sources7 archives

Databases and archives Megachile prosopidis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility853 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF853 records

Environmental DNA1 datasets · 2 countries23 detections

DNA & barcodingBOLD11 specimens

01Narrative

Megachile prosopidis is a species of bee in the family Megachilidae. It was described by Theodore Dru Alison Cockerell in 1900.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)3.12 mm

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Megachile prosopidis has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections23

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

11Amostly conserved

23Tmostly conserved

34Amostly conserved

220Tmostly conserved

235Cmostly conserved

259Cvariable

365Cmostly conserved

494Amostly conserved

535Amostly conserved

556Cvariable

651Amostly conserved

AATAATATACATAATTTTTGCTTTATGAGCAGGAATAGTAGGTTCATCTATAAGAATAATTATTCGAATAGAACTAAGTACTCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.54%

Haplotypes4

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megachile davidsonisame genus1.6%Megachile odontostomasame genus12.9%Megachile flabellipessame genus13.4%Megachile albisectasame genus13.6%Megachile frugalissame genus14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type853 records

Wild obs. + sensor15

Museum / vouchered818

Other20

Range

Area of Occupancy AOO780 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 9≤1 km 1≤10 km 1>10 km 1

12 georeferenced · 3 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 214≤1 km 2≤10 km 9>10 km 30

255 georeferenced · 563 without coordinates

Open the institutions mapphysical evidence818

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	424
Lubbock, US	115
University of Alabamalocation not on record	87
La Jolla, US	74
	64
Ciudad de México, MX	21
Mexico City, MX	19
Albuquerque, US	6
Cambridge, US	3
WIlocation not on record	2
EL PASO, US	1
US	1
Essig Museum of Entomologylocation not on record	1

13 institutions · 818 of 818 vouchered records shown

09Environmental DNA23 detections

Where the DNA of Megachile prosopidis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.9 °C 21.5–30.3

Seasonal swing summer↔winter20.2 °C

Max temp (day)33.9 °C 27.7–36.0

Min temp (night)21.2 °C 15.0–24.5

Precipitation59.4 mm/mo 33.2–72.5

Air humidity47.4 % 42.5–49.5

Moisture balance-101 mm/mo -134–-89.2

Vapour deficit2,041 Pa 1,327–2,382

Wind speed2.10 m/s 1.50–2.90

Cloud cover17.9 % 13.8–22.2

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)