Megachile policaris

Say, 1831 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Megachile

At a glance

Occurrence records2 679

Data sources7

Biological traits1

DNA specimens27

eDNA detections31

Sources7 archives

Databases and archives Megachile policaris's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 679 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 679 records

Environmental DNA1 datasets · 1 countries31 detections

DNA & barcodingBOLD27 specimens

01Narrative

Megachile policaris is a species of bee in the family Megachilidae. It was described by Say in 1831.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)3.35 mm

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Megachile policaris has left across the world's sequence archives.

At a glance

DNA specimens27

BINs1

Marker genes1

eDNA detections31

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P322 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.09%

Haplotypes2

BIN1

Most divergent pair0.31%

Where individuals differ — all 1 variable positions, in barcode order

316Tmostly conserved

TTACCCACCTTTATCATTAAATACATTTCATCCATCACCTTCAGTTGATTTAGCAATTTTTTCTTTACACTTATCAGGTATTTCTTCAAT …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 679 records

Wild obs. + sensor906

Museum / vouchered1 744

Other29

Range

Area of Occupancy AOO4 268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 470≤1 km 160≤10 km 34>10 km 106

770 georeferenced · 136 without coordinates

Open the mapobservation + sensor906

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 79≤1 km 20≤10 km 181>10 km 65

345 georeferenced · 1 399 without coordinates

Open the institutions mapphysical evidence1 744

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
	502
Wuzhou, CN	439
Beltsville, US	253
University of Alabamalocation not on record	200
Cambridge, US	70
Lubbock, US	43
Mexico City, MX	29
ASUlocation not on record	24
College Station, US	16
Albuquerque, US	15
San Diego, US	15
WIlocation not on record	14
Ciudad de México, MX	12
Montgomery, US	11
Champaign, US	10
Lake Placid, US	8
Tapachula, MX	8
Cornell University Insect Collectionlocation not on record	8
San Nicolás de los Garza, MX	7
University of Central Floridalocation not on record	7
La Jolla, US	6
OSUClocation not on record	6
Denton, US	4
US	3
ECOSUR-SClocation not on record	3
Universidad Católica de Manizaleslocation not on record	2
Mississippi State, US	2
EL PASO, US	1
Awka, NG	1
Colorado State Universitylocation not on record	1
University of Arizona, Insect Collectionlocation not on record	1

31 institutions · 1 721 of 1 744 vouchered records shown · 23 without an institution code

09Environmental DNA31 detections

Where the DNA of Megachile policaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map1 country0

sonoran desert

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 19.5–26.5

Seasonal swing summer↔winter3.40 °C

Max temp (day)28.0 °C 23.5–32.5

Min temp (night)21.8 °C 14.8–23.3

Precipitation45.8 mm/mo 31.8–111

Air humidity63.5 % 51.3–66.6

Moisture balance-112 mm/mo

Vapour deficit1,164 Pa 814–1,659

Wind speed2.80 m/s

Cloud cover21.6 % 19.6–32.3

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Megachile policaris

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type2 679 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions21 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 679 records