Megachile ligniseca

(Kirby, 1802) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Megachile

At a glance

Occurrence records4 383

Data sources9

Biological traits2

DNA specimens44

eDNA detections39

Sources9 archives

Databases and archives Megachile ligniseca's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 383 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 383 records

Environmental DNA1 datasets · 9 countries39 detections

DNA & barcodingBOLD44 specimens

Genome at a glanceGoaT · NCBI≈290 Mbp

01Narrative

Megachile ligniseca is a species of bee in the family Megachilidae. It was described by William Kirby in 1802.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology2

Hair length0.51 mm

Intertegular distance (ITD)3.48 mm

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Megachile ligniseca has left across the world's sequence archives.

At a glance

DNA specimens44

BINs2

Marker genes1

eDNA detections39

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

7Amostly conserved

40Tmostly conserved

442Tmostly conserved

GATCCTATATATAATTTTTGCACTATGGTCCGGAATAGTTGGATCAAGTATGTCTATAATTATTCGTATGGAACTAAGTGTACCCGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes4

BINs2

Most divergent pair1.8%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megachile inermissame genus4.1%Megachile alpicolasame genus11.0%Megachile genalissame genus11.6%Megachile centuncularissame genus11.6%Megachile maritimasame genus11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Megachile ligniseca carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈290 020 865 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Megachile ligniseca0.29 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.2% BUSCO

08Occurrence & distribution

Record type4 383 records

Wild obs. + sensor2 328

Museum / vouchered2 017

Other38

Origin

Native328

Range

Area of Occupancy AOO8 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 1 017≤1 km 264≤10 km 976>10 km 2

2 259 georeferenced · 69 without coordinates

Open the mapobservation + sensor2 328

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 265≤1 km 380≤10 km 1 032>10 km 16

1 693 georeferenced · 324 without coordinates

Open the institutions mapphysical evidence2 017

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 48 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	474
Philadelphia, US	232
SLU Artdatabankenlocation not on record	221
Provincia di Livornolocation not on record	119
Musee d'Histoire Naturallelocation not on record	89
ULglocation not on record	79
Zürich, CH	68
Adam Mickiewicz University in Poznańlocation not on record	39
Natuurpuntlocation not on record	32
Bern, CH	27
Brussels, BE	17
KZMlocation not on record	15
ZMAAlocation not on record	14
PRAZlocation not on record	13
South Kensington, GB	12
Toyama, JP	10
Kushiro City Museumlocation not on record	10
Tilburg, NL	9
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	8
Natural History Museum Rotterdamlocation not on record	8
Muzeum Górnośląskie w Bytomiulocation not on record	7
NCMGlocation not on record	7
Bonn, DE	6
ZSMlocation not on record	6
Paro, BT	6
PRUNlocation not on record	6
Frauenfeld, CH	6
AGClocation not on record	6
Kuopio, FI	5
NMOKlocation not on record	5
Mons, BE	5
Metsähallituslocation not on record	5
MZLUlocation not on record	4
Museum zu Allerheiligen Schaffhausenlocation not on record	4
MNHWlocation not on record	4
Uniwersytet Łódzkilocation not on record	4
Ghent, BE	2
Natural History Museum, Londonlocation not on record	2
NHMOlocation not on record	2
Tartu, EE	2
Ugentlocation not on record	2
Geneva, CH	2
CBDClocation not on record	2
Stockholm, SE	2
University of Florence, Department of Biologylocation not on record	1
Tallinn, EE	1
neflocation not on record	1
Wuzhou, CN	1

48 institutions · 1 602 of 2 017 vouchered records shown · 415 without an institution code

09Environmental DNA39 detections

Where the DNA of Megachile ligniseca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map9 countries0

1.1. Boreal Forest|1. Forest & Woodland1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 10.2–19.7

Seasonal swing summer↔winter19.1 °C

Max temp (day)20.8 °C 14.6–23.6

Min temp (night)11.6 °C 5.40–14.6

Precipitation104 mm/mo 59.8–231

Air humidity60.6 % 57.7–64.2

Moisture balance-10.7 mm/mo -70.0–166

Vapour deficit722 Pa 444–964

Wind speed2.60 m/s 1.40–4.10

Cloud cover36.7 % 34.6–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Megachile ligniseca

At a glance

Sources9 archives

Size & morphology2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 383 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 48 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 383 records