Megachile exilis

Cresson, 1872 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Megachile

At a glance

Occurrence records829

Data sources7

Biological traits1

DNA specimens6

eDNA detections16

Sources7 archives

Databases and archives Megachile exilis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility829 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF829 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD6 specimens

01Narrative

Megachile exilis is a species of bee in the family Megachilidae. It was described by Cresson in 1872.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.4 mm

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Megachile exilis has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections16

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.2%

Haplotypes1

BINs2

Where individuals differ — all 14 variable positions, in barcode order

100Avariable

169Avariable

172Tvariable

178Cvariable

181Tmostly conserved

217Avariable

307Tvariable

337Amostly conserved

352Avariable

370Cvariable

397Cvariable

461Cmostly conserved

568Tvariable

646Tmostly conserved

AGTCATATATATAATCTTTGCATTATGATCAGGAATAGTGGGTTCATCATTAAGAATAATCATTCGAATAGAATTAAGAGTACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megachile chelostomoidessame genus9.0%Megachile otomitasame genus9.1%Megachile reflexasame genus10.2%Megachile campanulaesame genus11.1%Megachile newberryaesame genus11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type829 records

Wild obs. + sensor91

Museum / vouchered738

Range

Area of Occupancy AOO1 116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 43≤1 km 26≤10 km 3>10 km 14

86 georeferenced · 5 without coordinates

Open the mapobservation + sensor91

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤100 m 6≤10 km 67>10 km 12

85 georeferenced · 653 without coordinates

Open the institutions mapphysical evidence738

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	479
Champaign, US	44
Beltsville, US	39
Cambridge, US	37
North Carolina State University Insect Museumlocation not on record	28
Montgomery, US	22
College Station, US	14
	13
Philadelphia, US	9
WIlocation not on record	9
University Park, US	9
Cleveland Museum of Natural History, OH (CLEV)location not on record	7
Lexington, US	7
OSUClocation not on record	5
Chicago, US	4
University of Alabamalocation not on record	4
Mississippi State, US	2
LULlocation not on record	2
Lubbock, US	1
University of Arizona, Insect Collectionlocation not on record	1
Cornell University Insect Collectionlocation not on record	1

21 institutions · 737 of 738 vouchered records shown · 1 without an institution code

09Environmental DNA16 detections

Where the DNA of Megachile exilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.4 °C 25.9–26.4

Seasonal swing summer↔winter20.3 °C

Max temp (day)31.2 °C 30.8–31.2

Min temp (night)22.0 °C 21.7–22.0

Precipitation124 mm/mo 113–134

Air humidity59.5 % 59.5–59.8

Moisture balance-36.0 mm/mo -36.0–-25.2

Vapour deficit1,395 Pa 1,347–1,395

Wind speed1.80 m/s 1.70–1.80

Cloud cover28.6 % 27.5–28.8

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)