Megachile erythropyga

Smith, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Megachile

At a glance

Occurrence records350

Data sources5

Biological traits0

DNA specimens5

eDNA detections0

Sources5 archives

Databases and archives Megachile erythropyga's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility350 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF350 records

DNA & barcodingBOLD5 specimens

01Narrative

Megachile erythropyga is een vliesvleugelig insect uit de familie Megachilidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1853 door Smith.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Megachile erythropyga has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.16%

Haplotypes2

BIN1

Most divergent pair0.31%

Where individuals differ — all 2 variable positions, in barcode order

1Tvariable

344Tmostly conserved

TTATATATATAATTTTTGCTATATGATCAGGTATAATCGGATCTTCAATAAGAATAATCATTCGAATAGAATTAAGAACCCCAGGAGCAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megachile newberryaesame genus10.6%Megachile opacifronssame genus11.0%Megachile rotundatasame genus11.0%Megachile frugalissame genus11.0%Megachile fidelissame genus11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type350 records

Wild obs. + sensor165

Museum / vouchered103

Other82

Origin

Native2

Range

Area of Occupancy AOO688 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 86≤1 km 15≤10 km 19>10 km 16

136 georeferenced · 29 without coordinates

Open the mapobservation + sensor165

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 5≤10 km 12>10 km 2

19 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence103

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	36
Western Australian Museumlocation not on record	32
QVMAGlocation not on record	25
Sydney, AU	10

4 institutions · 103 of 103 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)