Megachile coquilletti

Cockerell, 1915 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Megachile

At a glance

Occurrence records843

Data sources6

Biological traits2

DNA specimens14

eDNA detections0

Sources6 archives

Databases and archives Megachile coquilletti's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility843 records↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF843 records

DNA & barcodingBOLD14 specimens

01Narrative

Megachile coquilletti is a species of bee in the family Megachilidae. It was described by Theodore Dru Alison Cockerell in 1915.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology2

Intertegular distance (ITD)3.18 mm

Tongue length5.39 mm

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Megachile coquilletti has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

46Tmostly conserved

49Amostly conserved

88Gmostly conserved

106Tmostly conserved

193Cmostly conserved

202Amostly conserved

217Amostly conserved

340Cmostly conserved

347Tmostly conserved

532Cmostly conserved

595Cmostly conserved

613Tmostly conserved

634Cmostly conserved

637Amostly conserved

GATACTATATATAATTTTTGCTTTATGATCAGGGATAGTGGGATCTAGATTATCAATAATTATTCGAATAGAATTAAGAATTCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.36%

Haplotypes6

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megachile lippiaesame genus5.2%Megachile texanasame genus5.5%Megachile cleomissame genus6.2%Megachile brevissame genus6.4%Megachile gentilissame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type843 records

Museum / vouchered700

Other143

Range

Area of Occupancy AOO1 196 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 40≤1 km 48≤10 km 19>10 km 6

113 georeferenced · 587 without coordinates

Open the institutions mapphysical evidence700

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	426
	52
Santa Cruz, US	47
University of California, Davislocation not on record	44
Wuzhou, CN	29
La Jolla, US	21
Oregon State Arthropod Collectionlocation not on record	18
Essig Museum of Entomologylocation not on record	14
University of Alabamalocation not on record	12
Cambridge, US	9
Weber State University, Bird and Mammal Collectionlocation not on record	8
San Diego, US	7
Natural History Museum of Utahlocation not on record	5
US	3
WSUClocation not on record	3

15 institutions · 698 of 700 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)