Megachile canifrons

Smith, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Megachile

At a glance

Occurrence records270

Data sources6

Biological traits0

DNA specimens4

eDNA detections0

Sources6 archives

Databases and archives Megachile canifrons's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility270 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF270 records

DNA & barcodingBOLD4 specimens

01Narrative

Megachile canifrons is a species of bee in the family Megachilidae. It was described by Smith in 1853.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Megachile canifrons has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

356Gvariable

ACTATATATAATTTTTGCTTTATGATCAGGAATAATTGGATCATCAATAAGAATTATTATTCGAATAGAATTAAGTACACCTGGATCATG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megachile oblongasame genus10.9%Megachile montenegrensissame genus11.3%Megachile subnigrasame genus13.0%Megachile melanogastersame genus13.2%Megachile inimicasame genus13.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type270 records

Wild obs. + sensor52

Museum / vouchered119

Other99

Range

Area of Occupancy AOO712 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 19≤1 km 4≤10 km 3>10 km 6

32 georeferenced · 20 without coordinates

Open the mapobservation + sensor52

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 13≤10 km 8>10 km 3

24 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence119

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	40
Western Australian Museumlocation not on record	33
Australian National Fish Collectionlocation not on record	30
Museums Victorialocation not on record	14
Research Collection of Kit S. Prendergastlocation not on record	1
Cambridge, US	1

6 institutions · 119 of 119 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)