Megachile bombycina

Radoszkowski, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Megachile

At a glance

Occurrence records142

Data sources6

Biological traits0

DNA specimens5

eDNA detections5

Sources6 archives

Databases and archives Megachile bombycina's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility142 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF142 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Megachile bombycina is a species of bee in the family Megachilidae. It was described by Radoszkowski in 1874.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Megachile bombycina has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes2

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AATTCTTTATATAATTTTTGCATTATGATCAGGAATAATTGGATCTAGAATATCAATAATTATTCGAATAGAATTAAGAACACCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Megachile octosignatasame genus7.6%Megachile centuncularissame genus7.6%Megachile lapponicasame genus7.6%Megachile semirufasame genus7.8%Megachile analissame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P28S

animal barcodemarker

08Occurrence & distribution

Record type142 records

Wild obs. + sensor31

Museum / vouchered111

Range

Area of Occupancy AOO180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy19% within 1 km

≤100 m 4≤1 km 1≤10 km 21

26 georeferenced · 5 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤1 km 2≤10 km 28>10 km 3

33 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence111

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	91
ZMAAlocation not on record	9
Philadelphia, US	6
MNHWlocation not on record	2
Wuzhou, CN	2
Muzeum Górnośląskie w Bytomiulocation not on record	1

6 institutions · 111 of 111 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Megachile bombycina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C -2.10–17.2

Seasonal swing summer↔winter26.2 °C

Max temp (day)20.2 °C 0.2–20.2

Min temp (night)14.2 °C -4.60–14.2

Precipitation78.3 mm/mo 53.2–78.3

Air humidity60.6 % 60.6–70.8

Moisture balance-35.6 mm/mo -35.6–21.6

Vapour deficit779 Pa 238–779

Wind speed2.20 m/s 2.20–3.40

Cloud cover49.6 % 49.6–59.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)