Medicago sativa
speciesAt a glance
Occurrence records226 905
Data sources14
Biological traits152
DNA specimens113
eDNA detections131
Sources14 archives
Databases and archives Medicago sativa's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility226 905 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI131 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics113 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources152 traits
Chemical compositionFooDB · LOTUS · NPASS5 945 compounds
Occurrence & distributionGBIF226 905 records
Environmental DNA4 datasets · 19 countries131 detections
DNA & barcodingBOLD · NCBI113 specimens
Genome at a glanceGIFT · GoaT · NCBI1.7 Gbp
01Narrative
La luzerne ou luzerne cultivée, « reine des plantes fourragères », parfois appelée « grand trèfle » ou « foin de Bourgogne », ou « alfalfa » est une espèce de plantes à fleurs dicotylédones de la famille des Fabaceae, sous-famille des Faboideae, originaire des régions tempérées du Proche-Orient et de l'Asie centrale. C'est une plante herbacée vivace, largement cultivée comme plante fourragère pour sa productivité, sa grande résistance à la sécheresse et sa richesse en protéines, en vitamines et en sels minéraux. L'espèce a été introduite par la culture dans toutes les régions tempérées du monde notamment dans toute l'Europe, l'Afrique du Nord et du Sud, l'Amérique du Nord et du Sud, l'Australie, la Nouvelle-Zélande et l'Asie de l'Est. Elle est très cultivée pour sa richesse en protéines et ses qualités d'amélioration des sols. Abondamment répandue dans les contrées tempérées, tant à l'état sauvage que cultivée, la luzerne est une des espèces fourragères les plus utilisées pour l'alimentation du bétail. Elle est aussi cultivée comme source industrielle de protéines et de carotène, et utilisée en diététique.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTAusTraitsWCVPUSDA
Size & morphology28
Fruit length4 mm
⚠ sources differ — AusTraits: 4 mm · GIFT: 5 mm
Fruit width6.5 mm
⚠ sources differ — AusTraits: 6.5 mm · GIFT: 5 mm
Fruit width max8 mm
Fruit width min4 mm
Leaf length16.5 mm
Leaf length max35 mm
Leaf length min8 mm
Leaf mass29.7 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 1 288 mm² · GIFT: 1 288 mm²
Leaf width6.5 mm
⚠ sources differ — AusTraits: 6.5 mm · GIFT: 15 mm
Leaf width max15 mm
Leaf width min1.5 mm
Plant height0.52 m
⚠ sources differ — GIFT: 0.52 m · AusTraits: 0.6 m · USDA: 0.549 m · TRY: 0.669 m
Plant height generative0.775 m
Plant height max1 m
Plant height min0.2 m
Seed length2.02 mm
⚠ sources differ — TRY: 2.02 mm · AusTraits: 2.5 mm · GIFT: 3.5 mm
Seed length max4 mm
Seed length min3 mm
Seed mass2.25 mg
Seed mass max3.73 mg
Seed mass min0.57 mg
Seed volume4.2 mm³
Seed volume max4.2 mm³
Seed volume min4.2 mm³
Seed width1.25 mm
⚠ sources differ — AusTraits: 1.25 mm · GIFT: 4 mm
Seed width max4 mm
Seed width min4 mm
Life cycle & reproduction39
After harvest regrowth rateModerate
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flower colourpurple
Flower conspicuousNo
Flower length max8 mm
Flower length min7 mm
Flowering endJul
Flowering startMay
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDARapid
Life formperennial or annual
Life spanperennial
Lifespan categoryLong
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualpresent
Resprout abilityNo
Seed number91 145
Seed spread rateSlow
Seedling vigorHigh
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment34
Active growth periodSpring, Summer, Fall
Adapted to coarse textured soilsNo
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatHigh
Climatetemperate
Climberself-supporting
Elevation max3 300 m
Elevation mean1 800 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureFine
Fruit colourblack
⚠ sources differ — GIFT: black · USDA: Brown
Fruit fleshinessdry
Fruit typelegume
Growth formherb
Growth form USDASingle Crown
Habitat GIFTcrop fields, forest edges, meadows, meadows: dry, mountains, old fields, shrubberies, steppe, stony places
Hedge toleranceNone
Known allelopathYes
Leaf compoundnesscompound
Leaf formoblong
Leaf retentionNo
Leaf shapelanceolate obovate
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min24 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry27
Anaerobic toleranceNone
C:N ratioLow
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementHigh
Fire resistantNo
Fire toleranceHigh
Frost free days min95 days
Leaf c423 mg/g
Leaf dry-matter content (LDMC)262 mg/g
⚠ sources differ — TRY: 262 mg/g · LEDA: 213 mg/g
Leaf n39.62 mg/g
Leaf p2.23 mg/g
Moisture useHigh
Nitrogen fixation levelHigh
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Precipitation max47.5 in
Precipitation min14 in
Protein potentialHigh
Salinity toleranceMedium
Seed longevity index0.5
Shade toleranceHigh
Soil pH max7.85 pH
Soil pH min6.1 pH
Specific leaf area (SLA)23.52 mm²/mg
⚠ sources differ — TRY: 23.52 mm²/mg · LEDA: 25.65 mm²/mg · GIFT: 21.95 mm²/mg
Temperature min-38 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalHigh
Palatable humanYes
Post productNo
Pulpwood productNo
Seeds per pound226 800 per lb
ToxicityNone
Veneer productNo
Other traits7
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Seeds per fruit>1000
Shoot orientationascending
03Chemical composition5 945 compounds
Compounds documented for Medicago sativa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingHerbs and Spices
Compound class profile5 classes
Aminoacids107
Oleanane triterpenoids59
Glycerophospholipids57
Flavones55
Monosaccharides47
Documented compounds5 945 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Nitrogen | 5,600 mg/100 g | FooDB | |
| L-Leucine | 270 mg/100g | FooDB | |
| (Z,Z)-9,12-Octadecadienoic acid | 234 mg/100g | FooDB | |
| epsilon-Polylysine | 214 mg/100g | FooDB | |
| Sugars | 180 mg/100g | FooDB |
05DNA & barcoding113 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Medicago sativa has left across the world's sequence archives.
At a glance
DNA specimens113
Marker genes12
GenBank sequences8
eDNA detections131
Countries19
The DNA barcodea real sequence read deposited for this species
CATATCGAATCCCCTTGCCAATTTCCTATTTATTAGGTATTGCGTGCAGGGTGAATATGTTGGCCTCCCGTGAGCTCTGTCTCGTGGTTG …
Medicago sativa voucher TJ-8 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL2★rbcLa★trnL-F★ITS5★ITS1★ITS2atpF-atpHcp-trnL-intronrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemarker
Organelle genome
Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.
▸ Tap any coloured segment — or a gene chip — to see what it is
Mitochondrion
NC_068105 ↗ · 33 protein · 18 tRNA · 3 rRNA
nad2ccmBatp8atp6rps4rps12nad3nad4ccmCrps1nad5nad6nad9atp1cox2rpl16rps3rpl5rps14cobccmFnnad1matRatp9nad7mttB+9
Pick a coloured segment on the ring — or a gene chip — to read what that gene does.
protein-codingrRNAtRNA
06Genome at a glanceGIFT · GoaT · NCBI
The complete instruction manual Medicago sativa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 652 820 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Medicago sativa1.65 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidy4× tetraploid · measured
Chromosome records16–642n range32median32mode8records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 325×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
GIFT · GIFT (floras)
2n 161×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 481×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 641×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelComplete Genome
08Occurrence & distribution
Record type226 905 records
Wild obs. + sensor212 033
Museum / vouchered11 170
Cultivated / captive448
Other3 254
Origin
Native4 861
Introduced3 212
Range
Area of Occupancy AOO336 908 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy50% within 1 km
≤100 m 67 672≤1 km 19 677≤10 km 86 625>10 km 1 969
175 943 georeferenced · 36 090 without coordinates
Open the mapobservation + sensor212 033
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy45% within 1 km
≤100 m 693≤1 km 1 809≤10 km 2 751>10 km 266
5 519 georeferenced · 5 651 without coordinates
Open the institutions mapphysical evidence11 170
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 36>10 km 11
47 georeferenced · 401 without coordinates
Open the mapnot free-living448
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions290 of 528 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 117 |
| BIO-UNIPIlocation not on record | 371 |
| Beijing, CN | 328 |
| Olocation not on record | 295 |
| Moscow State Universitylocation not on record | 273 |
| HUN003location not on record | 268 |
| Philadelphia, US | 226 |
| Museo Entomologico de Leonlocation not on record | 157 |
| Yangling, CN | 145 |
| Berlin, DE | 129 |
| Chongqing Museumlocation not on record | 121 |
| MeiseBGlocation not on record | 121 |
| Uniwersytet Warszawskilocation not on record | 119 |
| St. Paul, US | 118 |
| LDlocation not on record | 116 |
| Chengdu, CN | 103 |
| Québec, CA | 100 |
| Denver, US | 96 |
| Chadron, US | 95 |
| Saint Louis, US | 89 |
| ESP004location not on record | 88 |
| MAlocation not on record | 86 |
| Adelaide, AU | 85 |
| Albuquerque, US | 82 |
| Claremont, US | 79 |
| QAUlocation not on record | 74 |
| Pretoria, ZA | 71 |
| Guangzhou, CN | 68 |
| València, ES | 67 |
| Spearfish, US | 67 |
| Nanjing, CN | 66 |
| San Diego, US | 65 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 64 |
| Canberra, AU | 60 |
| Mount Annan, AU | 58 |
| Adam Mickiewicz University in Poznańlocation not on record | 57 |
| Flagstaff, US | 57 |
| Fort Worth, US | 56 |
| Pullman, US | 55 |
| ASUlocation not on record | 54 |
| Bronx, US | 54 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 54 |
| BClocation not on record | 49 |
| Brisbane, AU | 49 |
| Xining, CN | 49 |
| Chengdu, CN | 49 |
| Nagano City, JP | 49 |
| Riverside, US | 49 |
| Santa Barbara, US | 45 |
| Austin, US | 43 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 42 |
| Trondheim, NO | 42 |
| Bergen, NO | 41 |
| Canadian Department of Agriculturelocation not on record | 40 |
| Mexico City, MX | 40 |
| DOI/NPS, Greenbelt Parklocation not on record | 40 |
| Burlington, US | 40 |
| Kunming, CN | 39 |
| Odawara, JP | 39 |
| Ann Arbor, US | 38 |
| SLU Artdatabankenlocation not on record | 38 |
| Tartu, EE | 38 |
| Urumqi, CN | 36 |
| South Kensington, GB | 35 |
| BDBClocation not on record | 35 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 34 |
| Hobart, AU | 34 |
| BRNUlocation not on record | 33 |
| Jena Microbial Resource Collectionlocation not on record | 33 |
| CJBGlocation not on record | 33 |
| Entomological Society of Latvialocation not on record | 33 |
| New Haven, US | 32 |
| Shinshu Universitylocation not on record | 32 |
| Uppsala, SE | 31 |
| CICYTEXlocation not on record | 31 |
| Corvallis, US | 31 |
| WTUlocation not on record | 30 |
| Auckland, NZ | 30 |
| Zhengzhou, CN | 29 |
| Durango, MX | 29 |
| Davis, US | 28 |
| Wellington, NZ | 28 |
| College Park, US | 27 |
| KMNlocation not on record | 27 |
| Bern, CH | 27 |
| University of Stellenboschlocation not on record | 26 |
| University of New Hampshirelocation not on record | 26 |
| Tsukuba, JP | 26 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 25 |
| Green Bay, US | 25 |
| Podgorica, ME | 25 |
| Emporia, US | 25 |
| Moscow, US | 24 |
| Porto Alegre, BR | 24 |
| Cape Town, ZA | 24 |
| Université Lavallocation not on record | 24 |
| Acadia Universitylocation not on record | 24 |
| Kensington, AU | 24 |
| Chiba, JP | 24 |
| Provo, US | 24 |
| Granada, ES | 23 |
| Chicago, US | 23 |
| Bangkok, TH | 23 |
| EL PASO, US | 23 |
| Chapingo, MX | 23 |
| Logan, US | 23 |
| Kew, GB | 23 |
| Christchurch, NZ | 22 |
| Nanchong, CN | 22 |
| Salzburg, AT | 22 |
| Phoenix, US | 22 |
| Phyletisches Museum Jenalocation not on record | 21 |
| Bozeman, US | 21 |
| IDElocation not on record | 21 |
| Barcelona, ES | 21 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 20 |
| Madrid, ES | 20 |
| WINlocation not on record | 20 |
| Oskarshamn, SE | 20 |
| Dekalb, US | 20 |
| Armidale, AU | 19 |
| College of the Atlantic, Museumlocation not on record | 19 |
| Wlocation not on record | 19 |
| Durango, US | 18 |
| GMBAlocation not on record | 18 |
| Lanzhou, CN | 18 |
| Philadelphia, US | 18 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 18 |
| JP | 18 |
| Lubbock, US | 17 |
| Pamplona, ES | 17 |
| KIRMlocation not on record | 17 |
| Puebla, MX | 17 |
| Saint John, CA | 17 |
| NSMKlocation not on record | 17 |
| Pamplona, ES | 16 |
| San Bernardino, US | 16 |
| Bando, JP | 16 |
| Missoula, US | 15 |
| Tlalnepantla, MX | 15 |
| WNNUlocation not on record | 15 |
| Montréal, CA | 15 |
| Boise, US | 15 |
| San Luis Obispo, US | 15 |
| Pocatello, US | 14 |
| Grand Junction, US | 14 |
| Otaru, JP | 14 |
| DBF-NHMDlocation not on record | 14 |
| Tomioka, JP | 14 |
| Vancouver, CA | 14 |
| Mlocation not on record | 14 |
| UniKSlocation not on record | 13 |
| Urumqi, CN | 13 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 13 |
| GJOlocation not on record | 13 |
| Voronezh State Universitylocation not on record | 13 |
| TROMlocation not on record | 13 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 13 |
| University of Alberta Museumslocation not on record | 13 |
| Tallinn, EE | 13 |
| UChlocation not on record | 13 |
| Inner Mongolia Universitylocation not on record | 12 |
| Salamanca, ES | 12 |
| Natural History Museum Rotterdamlocation not on record | 12 |
| Allentown, US | 12 |
| Whitewater, US | 12 |
| Toyama, JP | 12 |
| Universidad de Caldas (UCaldas)location not on record | 12 |
| Edinburgh, GB | 12 |
| NMBU:MINAlocation not on record | 11 |
| Provincia di Livornolocation not on record | 11 |
| US | 11 |
| Alicante, ES | 11 |
| Madison, US | 11 |
| Karlsruhe, DE | 11 |
| Nishihara, JP | 10 |
| Zürich, CH | 10 |
| Mississippi State, US | 10 |
| Winterthur, CH | 10 |
| Bloomington, US | 10 |
| UTPLlocation not on record | 10 |
| Zürich, CH | 10 |
| Williamsburg, US | 10 |
| Stockholm, SE | 10 |
| Millersville, US | 9 |
| San Isidro, AR | 9 |
| Uniwersytet Śląski w Katowicachlocation not on record | 9 |
| Shanxi Institute of Biologylocation not on record | 9 |
| Tampa, US | 9 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 9 |
| Zapopan, MX | 9 |
| KR | 9 |
| Jyväskylä, FI | 9 |
| BAYLUlocation not on record | 9 |
| Taipei, TW | 9 |
| Denton, US | 9 |
| Paris, FR | 9 |
| Córdoba, AR | 8 |
| Jiangxi College of Educationlocation not on record | 8 |
| San Angelo, US | 8 |
| Keene State Universitylocation not on record | 8 |
| BFLlocation not on record | 8 |
| McWane Science Centerlocation not on record | 8 |
| Valparaiso, CL | 8 |
| Guilin, CN | 8 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 8 |
| CASlocation not on record | 8 |
| Changsha, CN | 8 |
| Turlock, US | 8 |
| BISHlocation not on record | 8 |
| Tokushima, JP | 8 |
| Irvine, US | 8 |
| Lincoln, US | 8 |
| Los Angeles, US | 7 |
| Brussel, BE | 7 |
| BGR001location not on record | 7 |
| Tilburg, NL | 7 |
| Porrentruy, CH | 7 |
| Universidad de Antioquia (UdeA)location not on record | 7 |
| Staten Island, US | 7 |
| Hiratsuka City Museumlocation not on record | 7 |
| Rishon Le Zion, IL | 7 |
| Badajoz, ES | 7 |
| Awka, NG | 7 |
| J. Rusek Collectionlocation not on record | 7 |
| Caldwell, US | 7 |
| Kyoto Universitylocation not on record | 7 |
| Kuopio, FI | 7 |
| nbflocation not on record | 7 |
| Long Beach, US | 7 |
| Torreón, MX | 6 |
| Kirksville, US | 6 |
| Istituto Agrario Castelnuovolocation not on record | 6 |
| Angwin, US | 6 |
| AZE003location not on record | 6 |
| Chapel Hill, US | 6 |
| Brookings, US | 6 |
| Zacatecas, MX | 6 |
| Mexico City, MX | 6 |
| Palmerston, AU | 6 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 6 |
| Görlitz, DE | 6 |
| Toronto, CA | 6 |
| Waverly, US | 5 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 5 |
| Davenport, US | 5 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 5 |
| Jaén, ES | 5 |
| Xian, CN | 5 |
| Northridge, US | 5 |
| Aarhus, DK | 5 |
| Rotorua, NZ | 5 |
| Durban, ZA | 5 |
| Castelar, AR | 5 |
| Nishihara, JP | 5 |
| Pomona Collegelocation not on record | 5 |
| Arcata, US | 5 |
| Miami, US | 5 |
| Universidad Católica de Oriente (UCO)location not on record | 5 |
| Honolulu, US | 5 |
| NSW Office of Environment and Heritagelocation not on record | 5 |
| Yukon Universitylocation not on record | 5 |
| Puerto Ayora, EC | 5 |
| US | 5 |
| Portland, US | 5 |
| Pittsburg, US | 5 |
| University of Guelph, OAC Herbariumlocation not on record | 5 |
| Herbarium of South China Botanical Gardenlocation not on record | 5 |
| Wuzhou, CN | 5 |
| Tacoma, US | 5 |
| GBR016location not on record | 5 |
| Henderson, US | 5 |
| POL003location not on record | 4 |
| Santa Cruz, US | 4 |
| Stephenville, US | 4 |
| OLAlocation not on record | 4 |
| Clemson, US | 4 |
| Vitoria, ES | 4 |
| Nanjing, CN | 4 |
| Ypsilanti, US | 4 |
| Sevilla, ES | 4 |
| Smithfield, AU | 4 |
| Sanda, JP | 4 |
| UIBlocation not on record | 4 |
| Norfolk, US | 4 |
| Springfield, US | 4 |
| Xinxiang, CN | 4 |
| Sendai, JP | 4 |
| Severin-McDaniel Insect Collectionlocation not on record | 4 |
| Cheney, US | 4 |
| Xiamen, CN | 4 |
| Obihiro Centennial City Museumlocation not on record | 4 |
| Chicago, US | 4 |
| Nagatoro-machi, Chichibu-gun, JP | 4 |
| Anchorage, US | 4 |
| Chicago, US | 3 |
| Wuhan, CN | 3 |
| Knoxville, US | 3 |
| Chinese Academy of Forestrylocation not on record | 3 |
| Fayetteville, US | 3 |
| Strecker Museum, Baylor Universitylocation not on record | 3 |
| Tempe, US | 3 |
| RJBJCIlocation not on record | 3 |
| Shanghai, CN | 3 |
| SXTCMlocation not on record | 3 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 3 |
| Córdoba, ES | 3 |
| Oswego, US | 3 |
| Museum of the Rockieslocation not on record | 3 |
| Garðabær, IS | 3 |
| Hermosillo, MX | 3 |
| KURAlocation not on record | 3 |
| San Francisco, US | 3 |
| Beijing, CN | 3 |
| Juriquilla, MX | 3 |
| GB | 3 |
| La Paz, MX | 3 |
| Bourges, FR | 3 |
| Ivano-Frankivsk, UA | 3 |
| Fukushima Universitylocation not on record | 3 |
| Shenyang Agricultural Universitylocation not on record | 3 |
| Minia, EG | 3 |
| SWE054location not on record | 3 |
| ENTClocation not on record | 3 |
| US | 3 |
| Washington, US | 3 |
| BSBIlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Columbia, US | 3 |
| Seoul, KR | 3 |
| Mount Pleasant, US | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 3 |
| Dover, US | 3 |
| KNAMlocation not on record | 3 |
| National Institute of Biological Resourceslocation not on record | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| USFS/BHSClocation not on record | 3 |
| Monastir, TN | 3 |
| New Brunswick, US | 3 |
| Oulu, FI | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Universidad Católica de Santa Maríalocation not on record | 2 |
| PUC-RSlocation not on record | 2 |
| Eastern Nevada Landscape Coalitionlocation not on record | 2 |
| Cambridge, US | 2 |
| TUR-Alocation not on record | 2 |
| Shanxi Universitylocation not on record | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| Turku, FI | 2 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 2 |
| JBRJlocation not on record | 2 |
| Jefferson City, US | 2 |
| Parkville, AU | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Taiyuan Normal Universitylocation not on record | 2 |
| Servico de Microbiologia e Imunologialocation not on record | 2 |
| Jackson, US | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| La Paz, BO | 2 |
| TAIElocation not on record | 2 |
| Sion, CH | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| Portland, US | 2 |
| USFSlocation not on record | 2 |
| Arizona Western Collegelocation not on record | 2 |
| Meguro Parasitological Museumlocation not on record | 2 |
| University of Lethbridgelocation not on record | 2 |
| Coimbra, PT | 2 |
| Beijing Normal Universitylocation not on record | 2 |
| Bend, US | 2 |
| Glarus, CH | 2 |
| Balochistan University of Information Technology, Engineering and Management Scienceslocation not on record | 2 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 2 |
| University of British Columbia, Herbariumlocation not on record | 2 |
| Lausanne, CH | 2 |
| Montecillo, Texcoco, MX | 2 |
| Frauenfeld, CH | 2 |
| CNF-UFHBlocation not on record | 2 |
| Lake Charles, US | 2 |
| Guiyang, CN | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Londrina, BR | 2 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 2 |
| Nijmegen, NL | 2 |
| Hamilton, US | 2 |
| Tromso University Museumlocation not on record | 2 |
| Minot State Universitylocation not on record | 2 |
| Whitehorse, CA | 2 |
| Tula State Universitylocation not on record | 2 |
| Yunnan Universitylocation not on record | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| Orem, US | 2 |
| Wuhan, CN | 2 |
| QVMAGlocation not on record | 2 |
| VALElocation not on record | 2 |
| Chongqing Natural History Museumlocation not on record | 2 |
| Hangzhou, CN | 2 |
| nlocation not on record | 2 |
| UFSClocation not on record | 2 |
| CONCOLlocation not on record | 2 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Batemans Bay, AU | 1 |
| La Trobe Universitylocation not on record | 1 |
| Bratislava, SK | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| IWEP FEB RASlocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| Fulda, DE | 1 |
| Göteborg, SE | 1 |
| BGPAlocation not on record | 1 |
| Riobamba, EC | 1 |
| Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 1 |
| St. Augustine, TT | 1 |
| Kushiro City Museumlocation not on record | 1 |
| KNFHClocation not on record | 1 |
| West China Subalpine Botanical Gardenlocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Bothell, US | 1 |
| Namur, BE | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| KOMlocation not on record | 1 |
| Quito, EC | 1 |
| Corrientes, AR | 1 |
| Capital Normal Universitylocation not on record | 1 |
| cslocation not on record | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 1 |
| Universite de Montpellierlocation not on record | 1 |
| Kochi, JP | 1 |
| SZUlocation not on record | 1 |
| BGBMlocation not on record | 1 |
| Sapporo, JP | 1 |
| Sevilla, ES | 1 |
| Guangzhou, CN | 1 |
| Linares, MX | 1 |
| ROM002location not on record | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| Gijón, ES | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| HUAlocation not on record | 1 |
| CNPlocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Bureau of Land Managementlocation not on record | 1 |
| Texas Lutheran Universitylocation not on record | 1 |
| Cambridge, US | 1 |
| ARM059location not on record | 1 |
| LPMMBHlocation not on record | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Guasave, MX | 1 |
| DMZ botanic gardenlocation not on record | 1 |
| San Luis Potosí, MX | 1 |
| ROM007location not on record | 1 |
| SVK001location not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Due West, US | 1 |
| SVN019location not on record | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| MKD001location not on record | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Tuscaloosa, US | 1 |
| Ensenada, MX | 1 |
| Little Rock, US | 1 |
| Hokkaido University Museumlocation not on record | 1 |
| Ashland, US | 1 |
| Fairfax, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| SEFlocation not on record | 1 |
| Samara National Research Universitylocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| Durham, US | 1 |
| Hudson, US | 1 |
| Wollongong, AU | 1 |
| Elocation not on record | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| CPATSAlocation not on record | 1 |
| Mérida, MX | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| DNSMlocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Philadelphia, US | 1 |
| Loja, EC | 1 |
| GHPG$location not on record | 1 |
| Altos de Pipe, VE | 1 |
| Weber State Universitylocation not on record | 1 |
| Rocky Mountain Biological Laboratorylocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| Post Graduate College Bannulocation not on record | 1 |
| Dresden, DE | 1 |
| Kingston, US | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| MEXUlocation not on record | 1 |
| FLASlocation not on record | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Taipei, TW | 1 |
| University of Southern Mississippilocation not on record | 1 |
| CBDClocation not on record | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| University of Johannesburglocation not on record | 1 |
| ISAlocation not on record | 1 |
| Xian, CN | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Banyoles, ES | 1 |
| NEAUlocation not on record | 1 |
| Sagamihara, JP | 1 |
| Cslocation not on record | 1 |
| Central China Normal Universitylocation not on record | 1 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| Northeastern Forestry Universitylocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
528 institutions · 10 184 of 11 170 vouchered records shown · 885 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA131 detections
Where the DNA of Medicago sativa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found131
Studies independent surveys4
Countries19
Verifiable raw sequence linked6
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 131 detections have coordinates
Open the map19 countries0
Low, dry area right next to Yellowstone Rive…grasslandon the roadsidePalearcticNeotropicDry calcareous grasslands
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median20.4 °C 11.5–24.4
Seasonal swing summer↔winter17.5 °C
Max temp (day)25.8 °C 14.2–30.7
Min temp (night)16.5 °C 5.50–18.2
Precipitation53.8 mm/mo 1.10–93.4
Air humidity53.2 % 53.2–63.0
Moisture balance-88.0 mm/mo -124–20.5
Vapour deficit1,023 Pa 520–1,427
Wind speed3.20 m/s 1.80–4.70
Cloud cover28.1 % 17.4–43.6
CHELSA 1981–2010, ~9 km grid, at location & month of 108 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.