Mecynogea lemniscata

(Walckenaer, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Mecynogea

At a glance

Occurrence records3 680

Data sources9

Biological traits50

DNA specimens19

eDNA detections17

Sources9 archives

Databases and archives Mecynogea lemniscata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 680 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

World Spider Trait DBMasaryk University50 traits · 9 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements9 literature sources50 traits

Occurrence & distributionGBIF3 680 records

Environmental DNA1 datasets · 1 countries17 detections

DNA & barcodingBOLD19 specimens

01Narrative

Mecynogea lemniscata, the basilica orbweaver, is a species of orb weaver in the spider family Araneidae. It is found in a range from the United States to Argentina. Basilica orbweaver, Mecynogea lemniscata

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 9 sources

Wolff et al. 2022Willey et al. 1992Schenkel 1953aLevi 1997McCook 1878McCook 1894Anderson & Prestwich 1982Birkhofer & Wolters 2012Pekár et al. 2012a

Morphometry43

ALE0.09 mm

AME0.14 mm

Abdomen height2.45 mm

Abdomen length4.77 mm

Abdomen width2 mm

Body length7.05 mm

Body mass0.047 mm

Cephalothorax height1.16 mm

Cephalothorax length2.62 mm

Cephalothorax width1.97 mm

Chelicerae basal part (paturon) length0.765 mm

Fang length0.41 mm

Femur I length3.6 mm

Femur I width0.39 mm

Femur II length3.25 mm

Femur III length2.5 mm

Femur IV length3.42 mm

Femur IV width0.35 mm

Leg I length13.15 mm

Leg II length12.25 mm

Leg III length9.71 mm

Leg IV length7.94 mm

Metatarsus I length3.2 mm

Metatarsus II length2.77 mm

Metatarsus III length2.1 mm

Metatarsus IV length2.57 mm

PLE0.11 mm

PME0.14 mm

Patella I length1.5 mm

Patella II length1.4 mm

Patella III length1 mm

Patella IV length1.02 mm

Spinneret PLS0.37 mm

Tarsus I length1.3 mm

Tarsus II length1.07 mm

Tarsus III length1.2 mm

Tarsus IV length0.91 mm

Tibia I length3.4 mm

Tibia I width0.27 mm

Tibia II length2.7 mm

Tibia III length1.5 mm

Tibia IV length1.88 mm

Tibia IV width0.29 mm

Predation4

Hunting guild 2aerial web builder

Prey OrderOrthopteroidea

Prey diversity4.92 mm

Web buildingyes

Physiology1

Resting metabolic rate0.0 mm

Biomechanics1

'Primary mode of locomotionhanging

Morphology1

Cribellumabsent

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mecynogea lemniscata has left across the world's sequence archives.

At a glance

DNA specimens19

BINs3

Marker genes3

eDNA detections17

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 64 variable positions, in barcode order

1Amostly conserved

13Amostly conserved

37Amostly conserved

43Amostly conserved

55Tmostly conserved

68Gmostly conserved

73Gmostly conserved

88Amostly conserved

100Amostly conserved

106Tmostly conserved

109Gmostly conserved

112Tmostly conserved

121Amostly conserved

127Amostly conserved

133Amostly conserved

139Avariable

169Tmostly conserved

181Tmostly conserved

184Tmostly conserved

190Amostly conserved

193Tmostly conserved

196Amostly conserved

217Amostly conserved

271Tmostly conserved

280Gmostly conserved

298Tmostly conserved

302Cmostly conserved

310Gmostly conserved

316Amostly conserved

319Amostly conserved

322Gmostly conserved

323Gmostly conserved

328Gmostly conserved

337Amostly conserved

343Tmostly conserved

347Tmostly conserved

349Gmostly conserved

355Amostly conserved

361Gmostly conserved

364Amostly conserved

382Tmostly conserved

421Amostly conserved

424Cmostly conserved

433Amostly conserved

463Cmostly conserved

481Gmostly conserved

484Amostly conserved

490Amostly conserved

493Amostly conserved

508Amostly conserved

511Amostly conserved

529Cmostly conserved

538Amostly conserved

557Tmostly conserved

562Tmostly conserved

565Amostly conserved

580Amostly conserved

616Tvariable

628Gvariable

631Avariable

640Cvariable

643Avariable

652Tmostly conserved

653Cvariable

AACATTATATTTAATTTTTGGTGCTTGAGCGGCTATAGTAGGAACTGCTATAAGTGTATTAATTCGAGTTGAGTTAGGACAGCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.6%

Haplotypes6

BINs3

Most divergent pair8.4%

N.AmericaOtherS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cyclosa walckenaerisame family10.5%Neoscona cruciferasame family11.1%Argiope keyserlingisame family11.2%Argiope trifasciatasame family11.3%Cercidia prominenssame family11.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type3 680 records

Wild obs. + sensor3 619

Museum / vouchered59

Other2

Range

Area of Occupancy AOO9 656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 1 890≤1 km 500≤10 km 133>10 km 469

2 992 georeferenced · 627 without coordinates

Open the mapobservation + sensor3 619

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 5≤1 km 2≤10 km 6

13 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence59

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	15
UFMGlocation not on record	9
Washington, US	8
Buenos Aires, AR	4
Instituto Biologico de Sao Paulolocation not on record	4
Mexico City, MX	3
Chicago, US	3
College Station, US	2
Museu Paraense Emílio Goeldilocation not on record	2
US	2
Ohio State University Acarology Laboratorylocation not on record	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Frankfurt am Main	1
UFPB-ARlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Champaign, US	1

16 institutions · 58 of 59 vouchered records shown · 1 without an institution code

09Environmental DNA17 detections

Where the DNA of Mecynogea lemniscata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map1 country0

Mixed Hardwoods

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 22.2–25.0

Seasonal swing summer↔winter22.6 °C

Max temp (day)27.2 °C 27.2–29.8

Min temp (night)18.2 °C 18.2–21.0

Precipitation137 mm/mo 96.5–137

Air humidity57.9 % 57.4–60.5

Moisture balance-53.5 mm/mo -68.7–-48.1

Vapour deficit1,122 Pa 1,122–1,274

Wind speed5.80 m/s 2.60–5.80

Cloud cover37.2 % 31.7–37.5

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mecynogea lemniscata

At a glance

Sources9 archives

Morphometry43

Predation4

Physiology1

Biomechanics1

Morphology1

At a glance

Record type3 680 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 680 records