Mecyna mustelinalis

Packard, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Mecyna

At a glance

Occurrence records754

Data sources7

Biological traits0

DNA specimens123

eDNA detections153

Sources7 archives

Databases and archives Mecyna mustelinalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility754 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI153 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics123 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF754 records

Environmental DNA1 datasets · 2 countries153 detections

DNA & barcodingBOLD123 specimens

01Narrative

Mecyna mustelinalis is a moth in the family Crambidae. It was described by Packard in 1873. It is found in North America, where it has been recorded from Alberta, Arizona, British Columbia, California, Manitoba, Montana, Nevada, Saskatchewan, Utah, Washingtonmothphotographersgroup and Yukon. The length of the forewings is 12.5–16.5 mm.Bug Guide Adults have been recorded on wing from March to August, with most records from July.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding123 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mecyna mustelinalis has left across the world's sequence archives.

At a glance

DNA specimens123

BINs3

Marker genes1

eDNA detections153

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus119 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

103Cmostly conserved

214Tmostly conserved

277Tmostly conserved

427Tmostly conserved

466Gmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes15

BINs3

Most divergent pair3.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mecyna luscitialissame genus3.2%Mecyna trinalissame genus4.4%Mecyna subsequalissame genus4.6%Mecyna lutealissame genus4.7%Mecyna auralissame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type754 records

Wild obs. + sensor174

Museum / vouchered580

Origin

Native16

Range

Area of Occupancy AOO1 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 85≤1 km 27≤10 km 5>10 km 12

129 georeferenced · 45 without coordinates

Open the mapobservation + sensor174

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 31≤1 km 29≤10 km 54>10 km 67

181 georeferenced · 399 without coordinates

Open the institutions mapphysical evidence580

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	89
Santa Barbara Museum of Natural Historylocation not on record	73
University of Guelph, Centre for Biodiversity Genomicslocation not on record	65
University of Alberta Museums (UAM)location not on record	58
Oregon State Arthropod Collectionlocation not on record	52
New Haven, US	49
San Francisco, US	18
Mississippi State, US	17
Los Angeles, US	16
Royal Saskatchewan Museumlocation not on record	14
Colorado State Universitylocation not on record	8
Essig Museum of Entomologylocation not on record	8
Denver, US	7
Centre for Biodiversity Genomicslocation not on record	4
East Lansing, US	2
Santa Cruz, US	2
Vernal, US	1
Cambridge, US	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
ASUlocation not on record	1

20 institutions · 486 of 580 vouchered records shown · 94 without an institution code

09Environmental DNA153 detections

Where the DNA of Mecyna mustelinalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found153

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 153 detections have coordinates

Open the map2 countries0

GrasslandMixed Habitat4. Native Grassland | 4.4. Temperate GrasslandRiparian Zone1. Forest & Woodland|1.4. Temperate ForestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 13.6–21.0

Seasonal swing summer↔winter25.8 °C

Max temp (day)23.2 °C 20.1–28.1

Min temp (night)10.8 °C 7.60–14.2

Precipitation49.5 mm/mo 6.10–73.2

Air humidity51.2 % 45.7–60.9

Moisture balance-73.9 mm/mo -153–-58.4

Vapour deficit892 Pa 661–1,231

Wind speed1.90 m/s 1.70–3.30

Cloud cover38.5 % 31.4–43.0

CHELSA 1981–2010, ~9 km grid, at location & month of 153 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)