Mecyna flavalis

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Mecyna

At a glance

Occurrence records3 358

Data sources9

Biological traits0

DNA specimens49

eDNA detections51

Sources9 archives

Databases and archives Mecyna flavalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 358 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 358 records

Environmental DNA1 datasets · 12 countries51 detections

DNA & barcodingBOLD49 specimens

Genome at a glanceGoaT · NCBI≈532 Mbp

01Narrative

Mecyna flavalis is a species of moth in the family Crambidae. It is known from most of Europe (except Ireland, Norway, Portugal, Slovenia and Ukraine)"Mecyna flavalis (Denis & Schiffermüller, 1775)" Fauna Europaea. Retrieved May 29, 2018. to Japan. The species was first described by Michael Denis and Ignaz Schiffermüller in 1775. The wingspan is 25–29 mm. Adults are on wing from July to August."63.039 BF1396 Mecyna flavalis ([Denis & Schiffermüller], 1775)". UKMoths. Retrieved May 29, 2018. The larvae feed on Galium mollugo, Artemisia campestris, Ballota, Reseda and Urtica urens.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mecyna flavalis has left across the world's sequence archives.

At a glance

DNA specimens49

BINs2

Marker genes1

eDNA detections51

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus49 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

38Amostly conserved

133Amostly conserved

169Tmostly conserved

268Gmostly conserved

478Tmostly conserved

580Amostly conserved

616Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.38%

Haplotypes7

BINs2

Most divergent pair1.2%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mecyna gracilissame genus4.1%Uresiphita gracilissame family4.1%Mecyna trinalissame genus4.9%Mecyna subsequalissame genus5.2%Mecyna asinalissame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Mecyna flavalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈531 616 342 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Mecyna flavalis0.53 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.7% BUSCO

08Occurrence & distribution

Record type3 358 records

Wild obs. + sensor2 225

Museum / vouchered1 054

Other79

Range

Area of Occupancy AOO5 000 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 843≤1 km 574≤10 km 391>10 km 24

1 832 georeferenced · 393 without coordinates

Open the mapobservation + sensor2 225

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 60≤1 km 328≤10 km 305>10 km 256

949 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence1 054

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	590
Provincia di Livornolocation not on record	85
DanishLepidopterologicalSocietylocation not on record	64
Tartu, EE	44
Zürich, CH	42
Salzburg, AT	39
Philadelphia, US	34
SLU Artdatabankenlocation not on record	23
Adam Mickiewicz University in Poznańlocation not on record	18
Kuopio, FI	17
Uniwersytet Łódzkilocation not on record	11
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	7
Stockholm, SE	6
DABUHlocation not on record	5
European Distributed Institute of Taxonomy (EDIT)location not on record	4
ZMAAlocation not on record	4
ZSMlocation not on record	3
University of Kaiserslauternlocation not on record	3
South Kensington, GB	3
Nijmegen, NL	2
NHMOlocation not on record	2
Rovaniemi, FI	1
Tallinn, EE	1

23 institutions · 1 008 of 1 054 vouchered records shown · 46 without an institution code

09Environmental DNA51 detections

Where the DNA of Mecyna flavalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found51

Studies independent surveys1

Countries12

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 51 detections have coordinates

Open the map12 countries0

dry grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 13.2–20.3

Seasonal swing summer↔winter21.1 °C

Max temp (day)22.2 °C 17.1–24.9

Min temp (night)13.0 °C 7.60–16.3

Precipitation89.5 mm/mo 51.8–158

Air humidity60.1 % 56.6–64.1

Moisture balance-34.2 mm/mo -70.7–61.4

Vapour deficit781 Pa 588–1,004

Wind speed3.00 m/s 2.30–4.70

Cloud cover34.9 % 30.9–41.1

CHELSA 1981–2010, ~9 km grid, at location & month of 45 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mecyna flavalis

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 358 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 358 records