Mecyclothorax ambiguus

(Erichson, 1842) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Mecyclothorax

At a glance

Occurrence records700

Data sources7

Biological traits0

DNA specimens7

eDNA detections1

Sources7 archives

Databases and archives Mecyclothorax ambiguus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility700 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF700 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD7 specimens

01Narrative

Mecyclothorax ambiguus is a species of ground beetle in the subfamily Psydrinae. It was described by Wilhelm Ferdinand Erichson in 1842.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mecyclothorax ambiguus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes2

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.53%

Haplotypes2

BIN1

Most divergent pair0.61%

Where individuals differ — all 7 variable positions, in barcode order

19Gmostly conserved

30Tmostly conserved

270Gmostly conserved

318Tmostly conserved

342Tmostly conserved

345Amostly conserved

577Cmostly conserved

ACATTATACTTTATTTTTGGTGCATGAGCTGGAATAGTAGGTACTTCTCTTAGAATATTAATTCGTGCCGAATTAGGTAATCCAGGTTCA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mecyclothorax rufipennissame genus1.7%Mecyclothorax karschisame genus2.0%Ophonus laticollissame family9.0%Calathus ambiguussame family9.1%Anchomenus dorsalissame family9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type700 records

Wild obs. + sensor21

Museum / vouchered679

Origin

Native1

Introduced1

Range

Area of Occupancy AOO504 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 17≤1 km 2≤10 km 1

20 georeferenced · 1 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 524≤1 km 29≤10 km 24>10 km 1

578 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence679

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tasmanian Museum & Art Gallerylocation not on record	550
DPIlocation not on record	63
Museums Victorialocation not on record	36
Auckland, NZ	14
Australian National Fish Collectionlocation not on record	4
MWLRlocation not on record	3
Sydney, AU	3
QVMAGlocation not on record	3
Natick, US	2

9 institutions · 678 of 679 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Mecyclothorax ambiguus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)