Mecostethus parapleurus

(Hagenbach, 1822) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Acrididae/Mecostethus

At a glance

Occurrence records45 561

Data sources7

Biological traits0

DNA specimens15

eDNA detections0

Sources7 archives

Databases and archives Mecostethus parapleurus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility45 561 records↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF45 561 records

DNA & barcodingBOLD15 specimens

01Narrative

Mecostethus parapleurus is a species of band-winged grasshopper in the family Acrididae. It is found in the Palearctic.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mecostethus parapleurus has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

113Cmostly conserved

119Cmostly conserved

164Amostly conserved

170Tmostly conserved

292Cmostly conserved

320Cmostly conserved

323Amostly conserved

334Tmostly conserved

336Tmostly conserved

365Tmostly conserved

372Gmostly conserved

527Amostly conserved

528Cmostly conserved

CTTTATATTTTATATTTGGAGCATGAGCAGGAATAGTAGGAACATCAATAAGAATAATTATTCGTGCTGAATTAGGACAACCAGGATCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.44%

Haplotypes3

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Stethophyma lineatumsame family7.2%Stethophyma grossumsame family7.5%Acrida bicolorsame family10.4%Epacromius pulverulentussame family10.5%Conozoa sulcifronssame family10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type45 561 records

Wild obs. + sensor44 916

Museum / vouchered629

Other16

Origin

Native17 097

Range

Area of Occupancy AOO28 492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤100 m 5 113≤1 km 1 059≤10 km 36 839>10 km 90

43 101 georeferenced · 1 815 without coordinates

Open the mapobservation + sensor44 916

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 63≤1 km 188≤10 km 304>10 km 4

559 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence629

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ORTHATlocation not on record	192
Geneva, CH	48
Salzburg, AT	44
Zürich, CH	41
Bern, CH	28
Musee d'Histoire Naturallelocation not on record	19
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	16
Iwate Prefectural Museumlocation not on record	15
Toyama, JP	15
Omogo Mountain Museumlocation not on record	13
Provincia di Livornolocation not on record	11
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	6
Universität Zürich, Naturhistorisches Museumlocation not on record	5
Paro, BT	5
Sion, CH	5
University of Lodz, Department of Invertebrate Zoology and Hydrobiologylocation not on record	3
NSMKlocation not on record	3
ZSMlocation not on record	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
KNAMlocation not on record	1

20 institutions · 474 of 629 vouchered records shown · 155 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mecostethus parapleurus

At a glance

Sources7 archives

At a glance

Record type45 561 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 20 geolocated

Record type45 561 records