Meconema meridionale

Costa, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Tettigoniidae/Meconema

At a glance

Occurrence records65 586

Data sources9

Biological traits0

DNA specimens30

eDNA detections24

Sources9 archives

Databases and archives Meconema meridionale's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility65 586 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF65 586 records

Environmental DNA1 datasets · 6 countries24 detections

DNA & barcodingBOLD30 specimens

01Narrative

Meconema meridionale is an insect in the family Tettigoniidae, known as the southern oak bush cricket. It commonly measures 14 to 17 mm in length (not including antennae) and is carnivorous, arboreal and nocturnal. It has a more southerly distribution than its relative, Meconema thalassinum, being found in southern France, southwestern Germany, Italy, Switzerland, Austria, the former Yugoslavia and, since 2001, the United Kingdom. It is a predator of the horse-chestnut leaf miner, Cameraria ohridella. It is considered a species of least concern on the IUCN Red List as it is "widespread and common, and the population size is very large".

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Meconema meridionale has left across the world's sequence archives.

At a glance

DNA specimens30

BINs3

Marker genes1

eDNA detections24

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 36 variable positions, in barcode order

9Amostly conserved

25Avariable

28Amostly conserved

31Amostly conserved

34Amostly conserved

40Gvariable

43Tmostly conserved

67Tmostly conserved

79Tmostly conserved

91Tvariable

190Tmostly conserved

197Cmostly conserved

232Cmostly conserved

271Tmostly conserved

283Cmostly conserved

301Cmostly conserved

302Tmostly conserved

313Tmostly conserved

316Amostly conserved

346Avariable

349Cvariable

364Cvariable

373Amostly conserved

382Gmostly conserved

403Cmostly conserved

433Avariable

472Tmostly conserved

475Amostly conserved

485Tmostly conserved

505Cvariable

514Amostly conserved

574Cmostly conserved

586Tmostly conserved

631Avariable

634Tmostly conserved

658Tmostly conserved

AACACTTTACTTTATTTTCGGAGCATGAGCAGGAATAGTGGGTACTTCATTAAGAATACTTATTCGTGCAGAACTTGGTCAACCCGGCTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes5

BINs3

Most divergent pair1.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Similameconema sinicasame family11.4%Meconema thalassinumsame genus12.2%Toxomerus watsonisame order16.4%Rhingia caerulescenssame order17.0%Dideoides latussame order17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type65 586 records

Wild obs. + sensor65 344

Museum / vouchered236

Other6

Origin

Native2 146

Introduced234

Range

Area of Occupancy AOO71 672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 19 805≤1 km 3 478≤10 km 30 871>10 km 653

54 807 georeferenced · 10 537 without coordinates

Open the mapobservation + sensor65 344

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 33≤1 km 17≤10 km 135>10 km 3

188 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence236

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
EISlocation not on record	24
Salzburg, AT	18
ORTHATlocation not on record	17
Musee d'Histoire Naturallelocation not on record	15
Nijmegen, NL	11
Brussel, BE	10
Bonn, DE	8
Natural History Museum Rotterdamlocation not on record	6
ZSMlocation not on record	5
Geneva, CH	4
Paro, BT	4
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
Natural History Museum, Londonlocation not on record	3
MZLUlocation not on record	3
Bern, CH	2
Zürich, CH	2
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	2
South Kensington, GB	2
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
Provincia di Livornolocation not on record	1
Radicondoli, IT	1
SLU Artdatabankenlocation not on record	1

22 institutions · 144 of 236 vouchered records shown · 92 without an institution code

09Environmental DNA24 detections

Where the DNA of Meconema meridionale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map6 countries0

UrbanMaquisMediterranean forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 13.7–18.5

Seasonal swing summer↔winter18.9 °C

Max temp (day)20.4 °C 17.9–23.1

Min temp (night)12.0 °C 9.80–14.0

Precipitation62.5 mm/mo 52.6–83.4

Air humidity59.9 % 58.3–61.7

Moisture balance-25.3 mm/mo -67.6–0.5

Vapour deficit729 Pa 605–883

Wind speed2.90 m/s 2.10–3.70

Cloud cover38.8 % 32.9–41.6

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Meconema meridionale

At a glance

Sources9 archives

At a glance

Record type65 586 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type65 586 records