Mecomma ambulans

(Fallen, 1807) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Mecomma

At a glance

Occurrence records2 833

Data sources7

Biological traits0

DNA specimens9

eDNA detections160

Sources7 archives

Databases and archives Mecomma ambulans's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 833 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI160 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 833 records

Environmental DNA5 datasets · 7 countries160 detections

DNA & barcodingBOLD9 specimens

01Narrative

Mecomma ambulans is a species of bugs in the Miridae family that can be found throughout Europe (except for Portugal) and the far north, and through the Palearctic as far east as China. The species have black pronotum with brown wings and yellow legs, all of which is similar to Tupiocoris rhododendri.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mecomma ambulans has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes2

eDNA detections160

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P630 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)2.8%

Haplotypes1

BINs2

Where individuals differ — all 26 variable positions, in barcode order

6Avariable

69Cvariable

108Tvariable

135Gvariable

189Gvariable

195Cvariable

254Cvariable

312Tvariable

327Gvariable

333Avariable

372Avariable

378Tvariable

379Tvariable

435Cvariable

446Cvariable

447Avariable

457Tvariable

458Tvariable

462Gvariable

480Cvariable

483Avariable

498Avariable

511Tvariable

520Cvariable

537Gvariable

597Avariable

GCCGGAATATTAGGAACTTCACTTAGATGAATCATCCGTATCGAGCTAGGAATAGCTGGGGCATTCATCGGAGATGATCAAACCTATAAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mecomma gilvipessame genus7.9%Orthotylus sophoraesame family12.9%Orthotylus bilineatussame family13.5%Orthotylus boreellussame family14.0%Orthotylus katmaisame family14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type2 833 records

Wild obs. + sensor1 577

Museum / vouchered1 181

Fossil1

Other74

Range

Area of Occupancy AOO6 304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 738≤1 km 434≤10 km 314>10 km 17

1 503 georeferenced · 74 without coordinates

Open the mapobservation + sensor1 577

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 705≤1 km 232≤10 km 151>10 km 8

1 096 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence1 181

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	108
Jyväskylä, FI	77
NCMGlocation not on record	57
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	53
Natural History Museum, Aarhus Denmarklocation not on record	32
Tromsø, NO	32
SLU Artdatabankenlocation not on record	29
CBDClocation not on record	27
Tartu, EE	24
Uniwersytet Śląski w Katowicachlocation not on record	20
Metsähallituslocation not on record	17
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	16
Philadelphia, US	16
Helsinki, FI	15
Rovaniemi, FI	15
ZMAAlocation not on record	10
BioFokuslocation not on record	7
Bonn, DE	5
UO-CeStuBiolocation not on record	3
Kuopio, FI	2
NTNU, University Museumlocation not on record	2
neflocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Natural History Museum, Londonlocation not on record	1
South Kensington, GB	1
MZLUlocation not on record	1
Norwegian Institute of Bioeconomy Researchlocation not on record	1
Forssa, FI	1

28 institutions · 575 of 1 181 vouchered records shown · 606 without an institution code

09Environmental DNA160 detections

Where the DNA of Mecomma ambulans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found160

Studies independent surveys5

Countries7

Verifiable raw sequence linked148

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 160 detections have coordinates

Open the map7 countries0

Farmland, coast and birch habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 9.90–17.2

Seasonal swing summer↔winter23.7 °C

Max temp (day)17.0 °C 11.6–20.4

Min temp (night)9.80 °C 5.90–13.1

Precipitation101 mm/mo 74.1–144

Air humidity60.6 % 58.6–65.1

Moisture balance26.4 mm/mo -40.1–57.6

Vapour deficit612 Pa 419–813

Wind speed2.70 m/s 2.00–4.50

Cloud cover55.1 % 45.8–62.2

CHELSA 1981–2010, ~9 km grid, at location & month of 159 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mecomma ambulans

At a glance

Sources7 archives

At a glance

Record type2 833 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 833 records