Mecodina praecipua

(Walker, 1865) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Mecodina

At a glance

Occurrence records456

Data sources7

Biological traits0

DNA specimens20

eDNA detections18

Sources7 archives

Databases and archives Mecodina praecipua's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility456 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF456 records

Environmental DNA1 datasets · 4 countries18 detections

DNA & barcodingBOLD20 specimens

01Narrative

Mecodina praecipua is a moth of the family Noctuidae first described by Francis Walker in 1865.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mecodina praecipua has left across the world's sequence archives.

At a glance

DNA specimens20

BINs4

Marker genes2

eDNA detections18

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 61 variable positions, in barcode order

22Tmostly conserved

31Amostly conserved

40Amostly conserved

48Cmostly conserved

50Tmostly conserved

55Amostly conserved

85Tmostly conserved

91Amostly conserved

92Tmostly conserved

100Tmostly conserved

169Amostly conserved

197Tmostly conserved

202Tvariable

206Cvariable

214Amostly conserved

217Gvariable

220Cvariable

235Cmostly conserved

238Tmostly conserved

259Cmostly conserved

295Gvariable

337Tmostly conserved

349Tmostly conserved

376Amostly conserved

379Tvariable

382Amostly conserved

391Tmostly conserved

397Cvariable

400Avariable

412Amostly conserved

428Cvariable

433Amostly conserved

445Tmostly conserved

457Tmostly conserved

463Cvariable

479Tmostly conserved

487Tmostly conserved

500Tmostly conserved

502Amostly conserved

517Tmostly conserved

532Tmostly conserved

536Tmostly conserved

538Amostly conserved

539Tmostly conserved

541Amostly conserved

542Cmostly conserved

544Cvariable

556Tmostly conserved

574Tmostly conserved

595Cvariable

596Cmostly conserved

598Tmostly conserved

601Tmostly conserved

604Tmostly conserved

613Tmostly conserved

619Tmostly conserved

622Tmostly conserved

625Amostly conserved

628Tmostly conserved

646Tmostly conserved

653Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.0%

Haplotypes5

BINs4

Most divergent pair4.7%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lascoria aonsame family5.3%Catadoides punctatasame family5.5%Simplicia erebinasame family5.5%Bleptina caradrinalissame family5.6%Chaograptis crystallodessame order6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_070294 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type456 records

Wild obs. + sensor359

Museum / vouchered96

Other1

Range

Area of Occupancy AOO888 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 59≤1 km 59≤10 km 12>10 km 15

145 georeferenced · 214 without coordinates

Open the mapobservation + sensor359

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 1≤10 km 3>10 km 1

5 georeferenced · 91 without coordinates

Open the institutions mapphysical evidence96

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
tesrilocation not on record	64
Taiwan Forestry Research Institutelocation not on record	8
FACTlocation not on record	6
Museums Victorialocation not on record	5
Tallinn, EE	4
Helsinki, FI	2
ZSMlocation not on record	1
MZLUlocation not on record	1

8 institutions · 91 of 96 vouchered records shown · 5 without an institution code

09Environmental DNA18 detections

Where the DNA of Mecodina praecipua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 22.8–26.3

Seasonal swing summer↔winter6.00 °C

Max temp (day)28.2 °C 25.0–29.1

Min temp (night)21.2 °C 20.1–24.3

Precipitation263 mm/mo 187–400

Air humidity68.7 % 64.2–70.8

Moisture balance136 mm/mo

Vapour deficit959 Pa 922–1,095

Wind speed1.10 m/s

Cloud cover49.7 % 40.4–67.6

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)