Mecidea minor

Ruckes, 1946 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Mecidea

At a glance

Occurrence records130

Data sources6

Biological traits0

DNA specimens113

eDNA detections126

Sources6 archives

Databases and archives Mecidea minor's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility130 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI126 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics113 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF130 records

Environmental DNA1 datasets · 5 countries126 detections

DNA & barcodingBOLD113 specimens

01Narrative

Mecidea minor is a species of stink bug in the family Pentatomidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding113 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mecidea minor has left across the world's sequence archives.

At a glance

DNA specimens113

BINs1

Marker genes1

eDNA detections126

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P619 bp consensus112 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

69Amostly conserved

345Cmostly conserved

483Amostly conserved

568Tmostly conserved

TTCTTGTTTGGAATATGAGCTGGAATAGTAGGATCAGCTATAAGATTAATTATTCGTATTGAATTGGGACAACCTGGAAGATTTATTGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.25%

Haplotypes5

BIN1

Most divergent pair1.8%

N.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Thyanta accerrasame family10.3%Stagonomus bipunctatussame family10.8%Thyanta perditorsame family11.0%Chlorochroa uhlerisame family11.0%Thyanta pallidovirenssame family11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type130 records

Wild obs. + sensor18

Museum / vouchered112

Range

Area of Occupancy AOO328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 5≤1 km 2≤10 km 1>10 km 5

13 georeferenced · 5 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤1 km 1≤10 km 54>10 km 7

62 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence112

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	32
College Station, US	27
ASUlocation not on record	20
Provo, US	11
Durango, MX	6
San Francisco, US	4
North Carolina State University Insect Museumlocation not on record	4
Mexico City, MX	2
National Biodiversity Institute, Costa Ricalocation not on record	2
San Diego, US	1
Lubbock, US	1
US	1
München, DE	1

13 institutions · 112 of 112 vouchered records shown

09Environmental DNA126 detections

Where the DNA of Mecidea minor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found126

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 126 detections have coordinates

Open the map5 countries0

Urban14. Artificial - Terrestrial|14.5 Urban Areas1. Forest|1.4. Forest - Temperate1.4. Temperate Forest | 1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 18.6–25.0

Seasonal swing summer↔winter9.50 °C

Max temp (day)26.2 °C 23.5–29.6

Min temp (night)17.2 °C 14.2–18.2

Precipitation1.60 mm/mo 1.50–48.9

Air humidity63.5 % 56.3–63.9

Moisture balance-148 mm/mo -160–-69.2

Vapour deficit935 Pa 774–1,293

Wind speed1.50 m/s 1.50–3.50

Cloud cover12.2 % 10.9–27.6

CHELSA 1981–2010, ~9 km grid, at location & month of 122 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)