Mecaenichthys immaculatus

(Ogilby, 1885) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Pomacentridae/Mecaenichthys

At a glance

Occurrence records2 680

Data sources8

Biological traits6

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Mecaenichthys immaculatus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 621 records↗

OBISOcean Biodiversity Information System59 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS2 680 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

The immaculate damselfish (Mecaenichthys immaculatus), also known as the green puller, is a species of ray-finned fish, it is the only species in the monotypic genus Mecaenichthys, classified in the subfamily Pomacentrinae of the family Pomacentridae. The immaculate damselfish is distinguished from other species of damselfishes by having a pointed head with large eyes and bluish-silver coloured body with a thin blue iridescent margin around the caudal fin. The juveniles are orange in colour with bright blue iridescent stripes. The juveniles are similar to juveniles of the damselfish of the genus Parma. This species grows to 15 cm. The Immaculate damselfish is endemic to Australia where it is known from marine waters of southern Queensland to southern New South Wales. The species is found in depths of 0-55 m. The adults are found on rocky or weedy inshore reefs and form pairs during breeding. Their eggs are demersal and adhere to the substrate where they are guarded and aerated by the male.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length12 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits3

Depth max15 m

Depth min0 m

Vulnerability10

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mecaenichthys immaculatus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

CCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACAGCTTTAAGCCTTCTCATTCGGGCGGAACTAAGCCAACCGGGCGCTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chromis insolatasame family13.3%Chromis viridissame family13.3%Microspathodon bairdiisame family13.5%Chromis scottisame family13.8%Microspathodon chrysurussame family14.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

07Deep time~19.6 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin19.6 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type2 680 records

Wild obs. + sensor2 575

Museum / vouchered105

Range

Area of Occupancy AOO716 km²

Depth

0–200 m sunlit14

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 6.1 m · max 90 m · 14 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 566≤1 km 135≤10 km 17>10 km 7

725 georeferenced · 1 850 without coordinates

Open the mapobservation + sensor2 575

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 3≤1 km 21≤10 km 46>10 km 13

83 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence105

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	39
Natick, US	5
Western Australian Museumlocation not on record	3
Museums Victorialocation not on record	2
Wuzhou, CN	1
Cambridge, US	1
Toronto, CA	1
	1
Chicago, US	1

9 institutions · 54 of 105 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Mecaenichthys immaculatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.3 °C 16.7–21.0

Seasonal swing summer↔winter8.10 °C

Max temp (day)20.8 °C 19.0–22.2

Min temp (night)17.9 °C 14.5–19.7

Precipitation97.9 mm/mo 85.3–118

Air humidity60.5 % 59.5–61.7

Moisture balance-47.3 mm/mo -89.9–34.1

Vapour deficit885 Pa 772–953

Wind speed5.70 m/s 3.20–6.00

Cloud cover24.3 % 21.6–26.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mecaenichthys immaculatus

At a glance

Sources8 archives

Size & morphology1

Habitat & environment2

Other traits3

At a glance

At a glance

When this lineage existed

Record type2 680 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 680 records