Maytenus disticha

(Hook.fil.) Urb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Maytenus

At a glance

Occurrence records275

Data sources8

Biological traits15

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Maytenus disticha's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility275 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS · NPASS61 compounds

Occurrence & distributionGBIF275 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Maytenus disticha là một loài thực vật có hoa trong họ Dây gối. Loài này được (Hook.f.) Urb. mô tả khoa học đầu tiên năm 1904.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height0.717 m

Seed mass9.75 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formsubshrub or shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Wood density618 mg/cm³

03Chemical composition61 compounds

Compounds documented for Maytenus disticha across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Agarofuran sesquiterpenoids $ Eudesmane sesquiterpenoids5

Flavan-3-ols2

Antimycins2

Isocoumarins1

Phenazine alkaloids1

Documented compounds61 total

Tissue Source Quantified only

Compound	Amount	Source
(8S)-3-(2-Deoxy-\|A-D-erythro-pentofuranosyl)-3,4,7,8-tetrahydroimidazo[4,5-d][1,3]diazepin-8-ol	present	NPASS
2-Amino-3-hydroxy-4-methylbenzoic acid	present	NPASS
6-Acetylphenazine-1-carboxylic acid	present	NPASS
[(1S,2R,4S,5R,6S,7R,8R,9R,12R)-4,5,8,12-tetraacetyloxy-6-(acetyloxymethyl)-2,10,10-trimethyl-11-oxatricyclo[7.2.1.01,6]dodecan-7-yl] benzoate	present	LOTUS
[(1S,2R,4S,5R,6S,7R,8R,9R,12R)-4,5,8,12-tetraacetyloxy-6-(hydroxymethyl)-2,10,10-trimethyl-11-oxatricyclo[7.2.1.01,6]dodecan-7-yl] benzoate	present	LOTUS
[(1S,2R,5S,6S,7R,8R,9R,12R)-5,12-diacetyloxy-6-(acetyloxymethyl)-8-hydroxy-2,10,10-trimethyl-11-oxatricyclo[7.2.1.01,6]dodecan-7-yl] benzoate	present	LOTUS
[(1S,2R,5S,6S,7R,8R,9R,12R)-5,8,12-triacetyloxy-6-(acetyloxymethyl)-2,10,10-trimethyl-11-oxatricyclo[7.2.1.01,6]dodecan-7-yl] benzoate	present	LOTUS
[(1S,2R,5S,6S,7S,9R,12R)-5,12-diacetyloxy-6-(hydroxymethyl)-2,10,10-trimethyl-11-oxatricyclo[7.2.1.01,6]dodecan-7-yl] benzoate	present	LOTUS
[(1S,2S,5S,6S,7R,8S,9R,12R)-8,12-diacetyloxy-7-benzoyloxy-2-hydroxy-2,6,10,10-tetramethyl-11-oxatricyclo[7.2.1.01,6]dodecan-5-yl] benzoate	present	LOTUS
alpha-Catechin	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Maytenus disticha has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSEU328754.1 ↗705 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAGGCAGAACGACCCGCGAACAAGTGAAAAACTATCGCTCGCGGCAG …

Maytenus disticha 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type275 records

Wild obs. + sensor231

Museum / vouchered40

Cultivated / captive4

Origin

Native22

Range

Area of Occupancy AOO724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 102≤1 km 36≤10 km 13>10 km 9

160 georeferenced · 71 without coordinates

Open the mapobservation + sensor231

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 1≤10 km 2>10 km 2

5 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence40

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edinburgh, GB	10
San Isidro, AR	4
ASUlocation not on record	3
Buenos Aires, AR	2
Paris, FR	2
Chicago, US	2
Valparaiso, CL	2
Saint Louis, US	2
MeiseBGlocation not on record	2
UChlocation not on record	1
Stockholm, SE	1
MAlocation not on record	1
Kew, GB	1
Córdoba, AR	1
IANIGLAlocation not on record	1
Fundación Miguel Lillolocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Rotorua, NZ	1

18 institutions · 38 of 40 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Maytenus disticha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)