Maylandia greshakei — The Life Data

Animalia/Chordata/Perciformes/Cichlidae/Maylandia

At a glance

Occurrence records4

Data sources7

Biological traits7

DNA specimens3

eDNA detections0

Sources7 archives

Databases and archives Maylandia greshakei's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF4 records

DNA & barcodingBOLD3 specimens

01Narrative

William's mbuna (Maylandia greshakei), also known as ice blue zebra mbuna or ice blue zebra or the Pseudotropheus ice blue among the aquarium enthusiasts, is a species of cichlid fish endemic to Lake Malawi where it is only found at Makokola in the southeastern arm of the lake. This species can reach a length of 13.4 cm TL. It can also be found in the aquarium trade. The specific name honours the German ornamental fish importer Alfons Greshake.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length13.4 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max35 m

Depth min15 m

Vulnerability10

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Maylandia greshakei has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

301Gvariable

CCTCTATCTAGTATTTGGTGCTTGGGCCGGAATAGTAGGAACTGCACTTAGCCTCCTAATTCGGGCAGAACTAAGTCAGCCCGGCGCTCT …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type4 records

Museum / vouchered4

Range

Area of Occupancy AOO12 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

10Collections & institutions

Institution	Specimens
South African Institute for Aquatic Biodiversitylocation not on record	2
UEMlocation not on record	1
FishBaselocation not on record	1

3 institutions · 4 of 4 vouchered records shown