Matricaria chamomilla
speciesAt a glance
Occurrence records179 065
Data sources15
Biological traits67
DNA specimens37
eDNA detections60
Sources15 archives
Databases and archives Matricaria chamomilla's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility179 065 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI60 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics37 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources67 traits
Chemical compositionDukesPhytochem · LOTUS · NPASS404 compounds
Occurrence & distributionGBIF179 065 records
Environmental DNA1 datasets · 8 countries60 detections
DNA & barcodingBOLD · NCBI37 specimens
Genome at a glanceCCDB · GoaT · NCBI2.9 Gbp
01Narrative
La Camomille sauvage, Matricaire camomille, Petite camomille est une espèce de plante à fleurs de la famille des Astéracées et du genre Matricaria. Elle est parfois appelée camomille allemande, camomille vraie ou matricaire tronquée. C'est une plante médicinale utilisée depuis l'Antiquité gréco-latine, appelée simplement « camomille » en herboristerie. Elle ne doit pas être confondue avec deux autres plantes médicinales, appelées aussi localement « camomille » : la Grande camomille Tanacetum parthenium et la Camomille romaine Chamaemelum nobile.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology22
Fruit length1 mm
⚠ sources differ — AusTraits: 1 mm · GIFT: 4.5 mm
Fruit length max1 mm
Fruit length min0.8 mm
Fruit width0.8 mm
⚠ sources differ — AusTraits: 0.8 mm · GIFT: 3 mm
Fruit width max3 mm
Fruit width min3 mm
Leaf length70 mm
⚠ sources differ — AusTraits: 70 mm · GIFT: 35 mm
Leaf length max70 mm
Leaf length min30 mm
Leaf mass12.08 mg
Leaf size390 mm²
⚠ sources differ — LEDA: 390 mm² · GIFT: 334 mm²
Leaf width0.8 mm
Leaf width max20 mm
Leaf width min15 mm
Plant height0.235 m
⚠ sources differ — GIFT: 0.235 m · AusTraits: 0.6 m · LEDA: 0.235 m · TRY: 0.481 m
Plant height generative0.275 m
Plant height max0.6 m
Plant height min0.1 m
Seed length1.5 mm
Seed mass0.08 mg
⚠ sources differ — TRY: 0.08 mg · LEDA: 0.06 mg · GIFT: 0.052 mg
Seed mass max0.047 mg
Seed mass min0.04 mg
Life cycle & reproduction19
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flower colourwhite
Flower width max25 mm
Flower width min12 mm
Flowering endSep
Flowering startMay
Flowering timeyynnnnnnyyyy
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number5 500
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 600 m
Elevation mean1 800 m
Elevation min0 m
Epiphyteterrestrial
Fruit colourgreen
Fruit typeachene
Growth formherb
Habitat GIFTcrop fields, inhabited places, old fields, roadsides, ruderal sites
Leaf compoundnesssimple
Leaf formlinear
Leaf shapelinear
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)110 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)33.19 mm²/mg
⚠ sources differ — TRY: 33.19 mm²/mg · LEDA: 45.9 mm²/mg · GIFT: 38.55 mm²/mg
Other traits4
Diaspore typefruit
Leaf arrangementalternate
Plant support typefree-standing
Shoot orientationascending
03Chemical composition404 compounds
Compounds documented for Matricaria chamomilla across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Bisabolane sesquiterpenoids21
Flavonols16
Cinnamic acids and derivatives16
Flavones14
Acyclic monoterpenoids14
Documented compounds404 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| GALACTURONIC-ACID | 750,000 ppm | DukesPhytochem | |
| GALACTOSE | 150,000 ppm | DukesPhytochem | |
| MUCILAGE | 100,000 ppm | DukesPhytochem | |
| GLUCOSE | 70,000 ppm | DukesPhytochem | |
| EO | 20,000 ppm | DukesPhytochem | |
| CHAMAZULENE | 13,200 ppm | DukesPhytochem | |
| ALPHA-BISABOLOL | 10,000 ppm | DukesPhytochem | |
| APIGENIN | 8,400 ppm | DukesPhytochem | |
| BISABOLOL | 5,000 ppm | DukesPhytochem | |
| CHOLINE | 3,800 ppm | DukesPhytochem |
05DNA & barcoding37 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Matricaria chamomilla has left across the world's sequence archives.
At a glance
DNA specimens37
Marker genes8
GenBank sequences10
eDNA detections60
Countries8
The DNA barcodea real sequence read deposited for this species
ATCGCGTCGCCCCCAACAAACTATGTTGGGGGCGGATATTGGTCTCCCGTGCTTATGGCGTGGTTGGCCAAAATAGGAGTCCCTTCGATG …
Matricaria chamomilla voucher YGJ05 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL2★rbcLa★ITS7★ITS1★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Matricaria chamomilla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 934 000 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Matricaria chamomilla2.93 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records18–362n range18median18mode64records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1860×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +14
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Murín A., 1997: Karyotaxonomy of some medicinal and aromatic plants. - Thaiszia - J. Bot., Košice 7: 75-88.
CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · brit-fl — Kay, Q.O.N. (5.viii.1991)
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · iber-fl — Estudio citotaxonmico de la flora de las costas gallegas Lago Canzobre, E. & S. Castroviejo.Cadernos rea Ci. Biol.3: 1-215(1993).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4066
CCDB · fl-europaea — Fernandes & Queiros,
CCDB · poland — Pogan E., Rychlewski J. et al. 1980 a. Further studies in chromosome numbers of Polish Angiosperms. Part XIV. Acta Biol. Cracov. Ser. Bot. 22, 129-153.
CCDB · ipcn-api-dl — Madhusoodanan, K. J. & O. P. Arora. 1984. Preferential chromosomal transmission in Matricaria chamomilla L. Aneuploids. Cytologia 49: 551–556.
CCDB · ipcn-api-dl — Nagl, W. & F. Ehrendorfer. 1974. DNA content, heterochromatin, mitotic index and growth in perennial and annual Anthemideae (Asteraceae). Pl. Syst. Evol. 123: 35–54.
CCDB · ipcn-api-dl — Pogan, E. 1980. Further studies in chromosome numbers of Polish Angiosperms. Acta Biol. Cracov., Ser. Bot. 22: 129–153.
CCDB · ipcn-api-dl — Arora, O. P. & K. J. Madhusoodana. 1981. Nature of tetraploidy in Matricaria inodora L. Cytologia 46: 773–779.
CCDB · ipcn-api-dl — Murin, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Garcia, S., H. Inceer, T. Garnatje & J. Vallès. 2005. Genome size variation in some representatives of the genus Tripleurospermum. Biol. Pl. 49(3): 381–387.
CCDB · ipcn-api-dl — Samatadze, T. E. 1998. Comparative cytogenetic study of three species of the genus Matricaria L. Thesis Diss. Cand Biol. Sci. Moscow.
CCDB · ipcn-api-dl — Samatadze, T. E., O. V. Muravenko, G. I. Klimakhin & A. V. Zelenin. 1997. Intraspecies chromosome polymorphism in Matricaria chamomilla L. (syn. M. recutita L.) studied by C-banding technique. Genetika 33(1): 130–132.
CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Georgieva & V. A. Nikolova. 1986. Chromosome numbers of Bulgarian flowering plants. I. Fam. Asteraceae. Fitologija 31: 71–74.
CCDB · ipcn-api-dl — Peneva, P. C., B. A. Kuzmanov, V. P. Gluhčeva & S. B. Giorgeva. 1988. Morphological and karyological analysis of native populations of chamomile (Matricaria recutita L.). Fitologija 34: 28–42.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1979a. Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Zhurn. SSSR 64 (4): 582–589.
CCDB · ipcn-api-dl — Magulaev, A. J. 1979a. The chromosome numbers of flowering plants in the Northern Caucasus. Part 3. Flora of the North Caucasus and questions of its history,. 3: 101–106.
CCDB · ipcn-api-dl — Morton, J. K. 1977. A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211–223.
CCDB · ipcn-api-dl — Probatova, N. S. 2000. Chromosome numbers in some plant species from the Razdolnaya (Suifun) river basin (Primorsky Territory). Bot. Žhurn. (Moscow & Leningrad) 85(12): 102–107.
CCDB · ipcn-api-dl — Murín, A. 1997. Karyotaxonomy of some medicinal and aromatic plants. Thaiszia 7: 75–88.
CCDB · ipcn-api-dl — Vogt, R. & A. Aparicio. 1999. Chromosome numbers of plants collected during Iter Mediterraneum IV in Cyprus. Bocconea 11: 117–169.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · book-ipcn73-74 — NORDENSTAM, B. 1972. Chromosome numbers in some Compositae from Egypt. Bot. Notiser 125: 393-396.
CCDB · book-ipcn73-74 — GADELLA, T.W.J., & E. KLIPHUIS. 1973. Chromosome numbers of flowerinl plants in the Netherlands VI. Proc. Kon. Ned. Acad. Wet., ser. C 76: 303-311.
CCDB · book-indian_vol1 — Lundegardh, H. 1909 ; Beer, R. 1912; Hartwich, K. 1936 ; Tischler, G. 1934, 1937 ; Maude, P.F. 1939; Love, A. & Love, D. 1948 ; P6Iya, L. 1948; Tarnav- schi, I.T. 1948 ; Koul, M.L.H. 1964a ; Gadella, T.W.J. & Kliphuis, E. 1966; Fernandes, A. & Queiros, M. 1971
CCDB · eflora
CCDB · book-fedorov — Lundeglrdh 1909
CCDB · book-fedorov — Beer 1912
CCDB · book-fedorov — Hartwich 1936
CCDB · book-fedorov — Tischler 1934, 1937
+16 more references
2n 03×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Madhusoodanan, K. J. & Arora, O. P. (1979). Induced autotetraploidy in Matricaria chamomilla L. Cytologia 44: 227–232.
CCDB · CromoCat 2015 — Arora, O. P. & K. J. Madhusoodana. (1981). Nature of tetraploidy in Matricaria inodora L. Cytologia 46: 773–779.
CCDB · CromoCat 2015 — Pogan, E. (1980). Further studies in chromosome numbers of Polish Angiosperms. Part XIV. Acta Biol. Cracov., Ser. Bot. 22: 129-153.
2n 363×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Samatadze, T. E., O. V. Muravenko, G. I. Klimakhin & A. V. Zelenin. 1997. Intraspecies chromosome polymorphism in Matricaria chamomilla L. (syn. M. recutita L.) studied by C-banding technique. Genetika 33(1): 130–132.
CCDB · CromoCat 2015 — Samatadze, T. E., O. V. Muravenko, K. V. Popov & A. V. Zelenin. (2001). Genome comparison of the Matricaria chamomilla L. Varieties by chromosome C- and OR-banding patterns. Caryologia 54: 299–306.
2n 321×CCDB · book-indian_vol1
CCDB · book-indian_vol1 — Bara, I.I. 1979
n 06×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Arora, O. P. & K. J. Madhusoodana. (1981). Nature of tetraploidy in Matricaria inodora L. Cytologia 46: 773–779.
CCDB · CromoCat 2015 — Pogan, E. (1980). Further studies in chromosome numbers of Polish Angiosperms. Part XIV. Acta Biol. Cracov., Ser. Bot. 22: 129-153.
CCDB · CromoCat 2015 — Samatadze, T. E., O. V. Muravenko, K. V. Popov & A. V. Zelenin. (2001). Genome comparison of the Matricaria chamomilla L. Varieties by chromosome C- and OR-banding patterns. Caryologia 54: 299–306.
CCDB · CromoCat 2015 — Madhusoodanan, K. J. & Arora, O. P. (1979). Induced autotetraploidy in Matricaria chamomilla L. Cytologia 44: 227–232.
CCDB · CromoCat 2015 — Samatadze, T. E. (1998). Comparative cytogenetic study of three species of the genus Matricaria L. Thesis Diss. Cand Biol. Sci. Moscow
n 95×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Pogan, E. 1980. Further studies in chromosome numbers of Polish Angiosperms. Acta Biol. Cracov., Ser. Bot. 22: 129–153.
CCDB · ipcn-api-dl — Arora, O. P. & K. J. Madhusoodana. 1981. Nature of tetraploidy in Matricaria inodora L. Cytologia 46: 773–779.
CCDB · CromoCat 2015 — Turner, B. L., J. Bacon, L. Urbatsch, & B. Simpson. (1979). Chromosome numbers in South American Compositae. Amer. J. Bot. 66: 173-178.
CCDB · CromoCat 2015 — Arora, O. P. & K. J. Madhusoodana. (1981). Nature of tetraploidy in Matricaria inodora L. Cytologia 46: 773–779.
CCDB · CromoCat 2015 — Pogan, E. (1980). Further studies in chromosome numbers of Polish Angiosperms. Part XIV. Acta Biol. Cracov., Ser. Bot. 22: 129-153.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness97.6% BUSCO
08Occurrence & distribution
Record type179 065 records
Wild obs. + sensor174 186
Museum / vouchered4 566
Cultivated / captive22
Other291
Origin
Native1 038
Introduced10 243
Range
Area of Occupancy AOO265 764 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy41% within 1 km
≤100 m 20 434≤1 km 45 259≤10 km 95 491>10 km 725
161 909 georeferenced · 12 277 without coordinates
Open the mapobservation + sensor174 186
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy53% within 1 km
≤100 m 375≤1 km 1 060≤10 km 1 173>10 km 84
2 692 georeferenced · 1 874 without coordinates
Open the institutions mapphysical evidence4 566
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy11% within 1 km
≤1 km 2≤10 km 2>10 km 14
18 georeferenced · 4 without coordinates
Open the mapnot free-living22
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions163 of 293 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 201 |
| LDlocation not on record | 341 |
| BIO-UNIPIlocation not on record | 265 |
| Berlin, DE | 224 |
| Olocation not on record | 201 |
| Oulu, FI | 164 |
| Moscow State Universitylocation not on record | 149 |
| Turku, FI | 118 |
| Oskarshamn, SE | 92 |
| Salzburg, AT | 84 |
| SLU Artdatabankenlocation not on record | 80 |
| Durango, MX | 79 |
| Görlitz, DE | 57 |
| Trondheim, NO | 52 |
| Saint Louis, US | 41 |
| València, ES | 41 |
| Provincia di Livornolocation not on record | 37 |
| South Kensington, GB | 35 |
| Bern, CH | 33 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 31 |
| Uniwersytet Opolskilocation not on record | 29 |
| BFLlocation not on record | 27 |
| Adam Mickiewicz University in Poznańlocation not on record | 23 |
| Odawara, JP | 22 |
| Philadelphia, US | 21 |
| MAlocation not on record | 20 |
| Universidad de Antioquia (UdeA)location not on record | 20 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 19 |
| Uppsala, SE | 18 |
| BClocation not on record | 17 |
| BRNUlocation not on record | 16 |
| Chongqing Museumlocation not on record | 16 |
| Bergen, NO | 16 |
| Wuzhou, CN | 15 |
| Kuopio, FI | 15 |
| College of the Atlantic, Museumlocation not on record | 14 |
| Zürich, CH | 12 |
| GJOlocation not on record | 12 |
| Chiba, JP | 11 |
| Helsinki, FI | 11 |
| Rishon Le Zion, IL | 11 |
| Porvoo, FI | 11 |
| TUR-Alocation not on record | 10 |
| Salamanca, ES | 10 |
| Fayetteville, US | 10 |
| KR | 10 |
| Tallinn, EE | 10 |
| Córdoba, AR | 10 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 10 |
| Wlocation not on record | 9 |
| Stockholm, SE | 9 |
| St. Paul, US | 9 |
| GZUlocation not on record | 9 |
| Adelaide, AU | 9 |
| Universidad Católica de Oriente (UCO)location not on record | 8 |
| TROMlocation not on record | 8 |
| CICYTEXlocation not on record | 8 |
| Universidad de Caldas (UCaldas)location not on record | 8 |
| Puerto Ayora, EC | 8 |
| Zürich, CH | 7 |
| Mexico City, MX | 7 |
| Otaru, JP | 7 |
| Valparaíso, CL | 7 |
| PUC-RSlocation not on record | 7 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 7 |
| Bloomington, US | 7 |
| UNESClocation not on record | 7 |
| PrivatHerblocation not on record | 7 |
| Criciúma, BR | 7 |
| Maringá, BR | 6 |
| PRClocation not on record | 6 |
| Frauenfeld, CH | 6 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 6 |
| Tsukuba, JP | 6 |
| Montréal, CA | 6 |
| Herbario UTCEClocation not on record | 6 |
| Paris, FR | 6 |
| Granada, ES | 6 |
| Phyletisches Museum Jenalocation not on record | 5 |
| Jaén, ES | 5 |
| Entomological Society of Latvialocation not on record | 5 |
| Corrientes, AR | 5 |
| Universidad Industrial de Santander (UIS)location not on record | 5 |
| Córdoba, ES | 5 |
| Little Rock, US | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| Nagano City, JP | 5 |
| Alicante, ES | 4 |
| Ann Arbor, US | 4 |
| Mlocation not on record | 4 |
| Québec, CA | 4 |
| MeiseBGlocation not on record | 4 |
| Tilburg, NL | 4 |
| Blumenau, BR | 4 |
| JBRJlocation not on record | 4 |
| Frankfurt am Main | 4 |
| Edmonton, CA | 4 |
| University of Stellenboschlocation not on record | 4 |
| Vitoria, ES | 4 |
| Davis, US | 3 |
| Loja, EC | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Museo Entomologico de Leonlocation not on record | 3 |
| Nagatoro-machi, Chichibu-gun, JP | 3 |
| Aarhus, DK | 3 |
| BSBIlocation not on record | 3 |
| Kew, GB | 3 |
| Tartu, EE | 3 |
| San Diego, US | 3 |
| UNESP-FCAlocation not on record | 3 |
| Chadron, US | 3 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| Xiamen, CN | 3 |
| Tapachula, MX | 3 |
| Mount Annan, AU | 3 |
| Mexico City, MX | 3 |
| Badajoz, ES | 3 |
| Strecker Museum, Baylor Universitylocation not on record | 3 |
| Sanda, JP | 3 |
| San Luis Obispo, US | 3 |
| Sagamihara, JP | 3 |
| EL PASO, US | 3 |
| DBF-NHMDlocation not on record | 3 |
| Porrentruy, CH | 3 |
| Canberra, AU | 3 |
| Tromso University Museumlocation not on record | 3 |
| Staten Island, US | 3 |
| KMNlocation not on record | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| Wellington, NZ | 2 |
| Rovaniemi, FI | 2 |
| College Park, US | 2 |
| UTPLlocation not on record | 2 |
| Podgorica, ME | 2 |
| New Brunswick, US | 2 |
| Pelotas, BR | 2 |
| University of New Hampshirelocation not on record | 2 |
| Ivano-Frankivsk, UA | 2 |
| Puebla, MX | 2 |
| Toyama, JP | 2 |
| Nijmegen, NL | 2 |
| Hobart, AU | 2 |
| CJBGlocation not on record | 2 |
| UChlocation not on record | 2 |
| Winterthur, CH | 2 |
| Tula State Universitylocation not on record | 2 |
| FUVATESlocation not on record | 2 |
| Northridge, US | 2 |
| Mexico City, MX | 2 |
| Pullman, US | 2 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 2 |
| WINlocation not on record | 2 |
| New Haven, US | 2 |
| ROM020location not on record | 2 |
| WTUlocation not on record | 2 |
| Conway, US | 2 |
| POL003location not on record | 2 |
| Bangkok, TH | 2 |
| Kochi, JP | 2 |
| Osaka, JP | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| Kensington, AU | 2 |
| Dresden, DE | 2 |
| Université Lavallocation not on record | 2 |
| Glarus, CH | 2 |
| Valparaiso, CL | 2 |
| Madison, US | 2 |
| Tomioka, JP | 2 |
| Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record | 2 |
| Burlington, US | 2 |
| Sevilla, ES | 2 |
| Corvallis, US | 2 |
| Bourges, FR | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| GB | 2 |
| Viña del Mar, CL | 2 |
| Nanjing, CN | 2 |
| McWane Science Centerlocation not on record | 2 |
| LPMMBHlocation not on record | 1 |
| Bronx, US | 1 |
| Emporia, US | 1 |
| San Jose, US | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Cape Town, ZA | 1 |
| Firenze, IT | 1 |
| Claremont, US | 1 |
| Fribourg, CH | 1 |
| Logan, US | 1 |
| Université de Bordeauxlocation not on record | 1 |
| Ensenada, MX | 1 |
| IPA/SPlocation not on record | 1 |
| Brussel, BE | 1 |
| FLADlocation not on record | 1 |
| Uberlândia, BR | 1 |
| Service Commun des Laboratoires, Laboratoire de Strasbourglocation not on record | 1 |
| Porto Velho, BR | 1 |
| University of Patraslocation not on record | 1 |
| Zacatecas, MX | 1 |
| Dekalb, US | 1 |
| Boumlocation not on record | 1 |
| KIRMlocation not on record | 1 |
| ROM007location not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| San Luis Potosí, MX | 1 |
| Spearfish, US | 1 |
| Vancouver, CA | 1 |
| Linares, MX | 1 |
| Lake Charles, US | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Kawasaki Shi Tama Ku, JP | 1 |
| Kushiro City Museumlocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Monastir, TN | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| Shinshu Universitylocation not on record | 1 |
| Quito, EC | 1 |
| Fredericksburg, US | 1 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 1 |
| UIBlocation not on record | 1 |
| PLAlocation not on record | 1 |
| NSMKlocation not on record | 1 |
| Fukushima Universitylocation not on record | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| Museo civico di Ecologia e Storia naturale di Marano sul Panarolocation not on record | 1 |
| UEMlocation not on record | 1 |
| Cruz das Almas, BR | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| SIHUlocation not on record | 1 |
| La Paz, BO | 1 |
| National Museum Waleslocation not on record | 1 |
| León, NI | 1 |
| Palmerston North, NZ | 1 |
| Ashland, US | 1 |
| Brasília, BR | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 1 |
| SZUlocation not on record | 1 |
| UFRRJlocation not on record | 1 |
| Jyväskylä, FI | 1 |
| KIWElocation not on record | 1 |
| Universidade Federal do Vale do São Franciscolocation not on record | 1 |
| Philadelphia, US | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Foz do Iguaçu, BR | 1 |
| Flagstaff, US | 1 |
| SNSNMClocation not on record | 1 |
| Knoxville, US | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| La Paz, MX | 1 |
| UFBAlocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| LfUlocation not on record | 1 |
| Managua, NI | 1 |
| Sion, CH | 1 |
| Taipei, TW | 1 |
| Forssa, FI | 1 |
| Pamplona, ES | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Antiguo Cuscatlán, SV | 1 |
| QCNElocation not on record | 1 |
| Grand Junction, US | 1 |
| Göteborg, SE | 1 |
| Juriquilla, MX | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Alexandria Universitylocation not on record | 1 |
| Sendai, JP | 1 |
| UNIVASFlocation not on record | 1 |
| Salvador, BR | 1 |
| San José, CR | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| UFOPlocation not on record | 1 |
| UFPRlocation not on record | 1 |
| UERJlocation not on record | 1 |
| MEXUlocation not on record | 1 |
| Cenargenlocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Umeå Universitylocation not on record | 1 |
| Moscow University Herbarium (MW)location not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Minia, EG | 1 |
| Orem, US | 1 |
| Davenport, US | 1 |
| Green Bay, US | 1 |
293 institutions · 4 379 of 4 566 vouchered records shown · 124 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA60 detections
Where the DNA of Matricaria chamomilla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found60
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 60 detections have coordinates
Open the map8 countries0
Weedy place in park
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.1 °C 13.2–25.1
Seasonal swing summer↔winter2.20 °C
Max temp (day)30.2 °C 16.0–30.2
Min temp (night)21.3 °C 8.70–21.3
Precipitation164 mm/mo 76.4–164
Air humidity64.0 % 62.0–64.0
Moisture balance32.9 mm/mo -32.8–32.9
Vapour deficit1,154 Pa 575–1,154
Wind speed1.10 m/s 1.10–4.20
Cloud cover45.9 % 39.8–45.9
CHELSA 1981–2010, ~9 km grid, at location & month of 56 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.