Mastocarpus stellatus

(Stackhouse) Guiry, 1984 · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Gigartinales/Phyllophoraceae/Mastocarpus

At a glance

Occurrence records21 725

Data sources10

Biological traits1

DNA specimens60

eDNA detections50

Sources10 archives

Databases and archives Mastocarpus stellatus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 858 records↗

OBISOcean Biodiversity Information System10 867 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics60 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Chemical compositionLOTUS12 compounds

Occurrence & distributionGBIF · OBIS21 725 records

Environmental DNA3 datasets · 4 countries50 detections

DNA & barcodingBOLD · NCBI60 specimens

01Narrative

Mastocarpus stellatus, commonly known as carrageenan moss or false Irish moss, is a species in the Rhodophyceae division, a red algae seaweed division, and the Phyllophoracea family. M. stellatus is closely related to Irish Moss (Chondrus crispus). It grows in the intertidal zone. It is most collected in North Atlantic regions such as Ireland and Scotland, together with Irish moss, dried, and sold for cooking and as the basis for a drink reputed to ward off colds and flu. Marine biologists have completed studies on the medicinal reputation of M. stellatus to discover the full potential of its pharmaceutical benefits. Additionally, marine biologists have conducted research on its potential to serve as an alternative to plastic. The application of M. stellatus in these different industries is correlated with the seaweed's adaptations which developed in response to the environmental stressors present around its location on the rocky intertidal. Mastocarpus stellatus removed from the rocky intertidal

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

03Chemical composition12 compounds

Compounds documented for Mastocarpus stellatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Halogenated hydrocarbons9

Carotenoids (C40, β-β)1

Amarylidaceae alkaloids $ Phenylethylamines1

Pyrrolidine alkaloids1

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
(3R,3'R,13-cis)-beta,beta-Carotene-3,3'-diol	present	LOTUS
1-Bromopropane	present	LOTUS
1-Iodopentane	present	LOTUS
1-Iodopropane	present	LOTUS
Bromodichloromethane	present	LOTUS
Bromoform	present	LOTUS
Butyl iodide	present	LOTUS
Dibromochloromethane	present	LOTUS
Diiodomethane	present	LOTUS
Hordenine	present	LOTUS

05DNA & barcoding60 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mastocarpus stellatus has left across the world's sequence archives.

At a glance

DNA specimens60

BINs1

Marker genes4

GenBank sequences10

eDNA detections50

The DNA barcodea real sequence read deposited for this species

rbcLDQ023604.1 ↗247 bpFrance

ACGT

CTTCTACAGACACAGCTGATTTTGTAGAAACTCCAACAGCTAACGTTTAGATCATTTTAGTTTTCATTTAAACCATACACTAGAATCTAA …

Mastocarpus stellatus haplotype P4 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; rbcL-rbcS intergenic spacer, complete sequence; and ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit (rbcS) gene, partial cds; plastid

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mastocarpus pacificussame genus6.2%Mastocarpus vancouveriensissame genus7.8%Mastocarpus jardiniisame genus8.3%Mastocarpus californianussame genus8.3%Mastocarpus latissimussame genus8.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL10★ITS128S-D2

animal barcodeplant barcodefungal barcodemarker

08Occurrence & distribution

Record type21 725 records

Wild obs. + sensor7 372

Museum / vouchered9 737

Other4 616

Origin

Native1

Range

Area of Occupancy AOO14 636 km²

Depth

0–200 m sunlit633

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0.1 m · max 40 m · 633 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 5 137≤1 km 492≤10 km 600>10 km 17

6 246 georeferenced · 1 126 without coordinates

Open the mapobservation + sensor7 372

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 285≤1 km 1 248≤10 km 248>10 km 18

1 799 georeferenced · 7 938 without coordinates

Open the institutions mapphysical evidence9 737

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 47 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durham, US	937
Institut Francais pour l'Etude de la Merlocation not on record	780
486location not on record	462
Clocation not on record	403
DASSHlocation not on record	205
PNHSlocation not on record	94
South Kensington, GB	92
Chapel Hill, US	47
Ann Arbor, US	42
Alfred-Wegener-Institut für Polar- und Meeresforschunglocation not on record	26
LDlocation not on record	25
KMNlocation not on record	24
Madrid, ES	24
TROMlocation not on record	14
Trondheim, NO	12
Durham, US	12
Barcelona, ES	11
Burlington, US	11
ISAlocation not on record	9
València, ES	9
MeiseBGlocation not on record	8
Universidad de Oviedolocation not on record	8
	7
Museum national d'Histoire naturellelocation not on record	6
Bronx, US	5
University of Stellenboschlocation not on record	5
Tromsø, NO	5
Acadia Universitylocation not on record	4
Bourges, FR	4
Minia, EG	4
Auckland, NZ	2
Honolulu, US	2
BISHlocation not on record	2
McWane Science Centerlocation not on record	2
ARMS-MBONlocation not on record	1
Musée des Confluenceslocation not on record	1
Citadel Hill, GB	1
Vancouver, CA	1
Stockholm, SE	1
nbflocation not on record	1
Champaign, US	1
Tartu Fungal Culture Collectionlocation not on record	1
University of New Brunswick, Frederictonlocation not on record	1
Columbia, US	1
Philadelphia, US	1
CIBIOlocation not on record	1
Tampa, US	1

47 institutions · 3 316 of 9 737 vouchered records shown · 297 without an institution code

09Environmental DNA50 detections

Where the DNA of Mastocarpus stellatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys3

Countries4

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map4 countries0

Marine Protected Area; protected; 9.2 - Subt…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature21.5 °C 17.2–29.5

pH8.19 7.89–8.58

Conductivity46,400 µS/cm 44,700–50,100

Salinity34.6 PSU 33.6–35.5

Turbidity0.597 NTU

Nitrate0.429 µmol/L 0.187–1.26

Depth2.00 m 1.00–3.00

Coastal waterSediment

41 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 12.0–20.4

Seasonal swing summer↔winter8.10 °C

Max temp (day)16.6 °C 14.1–22.3

Min temp (night)13.0 °C 8.70–18.5

Precipitation99.7 mm/mo 79.9–126

Air humidity58.8 % 56.5–63.1

Moisture balance2.50 mm/mo -74.0–46.0

Vapour deficit735 Pa 560–920

Wind speed6.00 m/s 2.70–6.60

Cloud cover23.0 % 21.1–47.2

CHELSA 1981–2010, ~9 km grid, at location & month of 47 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mastocarpus stellatus

At a glance

Sources10 archives

Habitat & environment1

Compound class profile4 classes

Documented compounds12 total

At a glance

Record type21 725 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions24 of 47 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type21 725 records