Mastocarpus papillatus

(C.Agardh) Kützing, 1843 · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Gigartinales/Phyllophoraceae/Mastocarpus

At a glance

Occurrence records4 139

Data sources9

Biological traits2

DNA specimens78

eDNA detections79

Sources9 archives

Databases and archives Mastocarpus papillatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 282 records↗

OBISOcean Biodiversity Information System857 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI79 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics78 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS4 139 records

Environmental DNA2 datasets · 2 countries79 detections

DNA & barcodingBOLD · NCBI78 specimens

Genome at a glanceGoaT · NCBI≈31 Mbp

01Narrative

Mastocarpus papillatus, sometimes called Turkish washcloth, black tar spot, or grapestone is a species of red algae in the family Phyllophoraceae. It is sometimes confused with the distantly related Turkish towel (Chondracanthus exasperatus) which is of a similar texture but larger. The specific epithet papillatus ('with papillae') is due to the nipple-like projections on the female gametophyte which can give the texture of a terrycloth washcloth found at a Turkish bath.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding78 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mastocarpus papillatus has left across the world's sequence archives.

At a glance

DNA specimens78

BINs1

Marker genes5

GenBank sequences10

eDNA detections79

The DNA barcodea real sequence read deposited for this species

rbcLHQ437878.1 ↗1 349 bpUSA · 2004

ACGT

TACTGGCACTATTTCGTGTCAGTCCTCAACCAGGAGTGGATCCTGTTGAAGCATCTGCTGCAATTGCTGGTGAATCATCTACTGCAACTT …

Mastocarpus papillatus isolate M156 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mastocarpus alaskensissame genus6.3%Mastocarpus latissimussame genus11.5%Mastocarpus californianussame genus11.6%Mastocarpus rigidussame genus12.2%Mastocarpus agardhiisame genus12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL10★ITS128S28S-D2

animal barcodeplant barcodefungal barcodemarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_031166 ↗ · 26 protein · 22 tRNA · 2 rRNA

rps3rpl16cox1cox2tatAcox3ymf39cobnad6sdh2sdh3atp9rps11nad3nad1nad2sdh4nad4nad5atp8atp6orf172ymf16rps12rpl20nad4L+2

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Mastocarpus papillatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈31 352 538 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Mastocarpus papillatus0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type4 139 records

Wild obs. + sensor2 353

Museum / vouchered1 601

Other185

Range

Area of Occupancy AOO3 756 km²

Depth

0–200 m sunlit6

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0.2 m · max 0.2 m · 6 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 865≤1 km 155≤10 km 49>10 km 11

1 080 georeferenced · 1 273 without coordinates

Open the mapobservation + sensor2 353

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 12≤1 km 246≤10 km 156>10 km 4

418 georeferenced · 1 183 without coordinates

Open the institutions mapphysical evidence1 601

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chapel Hill, US	144
Vancouver, CA	103
University of Stellenboschlocation not on record	58
Ann Arbor, US	56
Edmonton, CA	26
Durham, US	25
San Diego, US	23
Arcata, US	19
US	18
Friday Harbor Laboratories, University of Washingtonlocation not on record	13
Davis, US	12
Durham, US	12
Corvallis, US	9
Severin-McDaniel Insect Collectionlocation not on record	8
Los Angeles, US	7
Stanford Universitylocation not on record	6
Auckland, NZ	6
Burlington, US	4
Bronx, US	4
McWane Science Centerlocation not on record	3
Minia, EG	3
WTUlocation not on record	2
University of Washingtonlocation not on record	2
Museo de Historia Natural, Universidad Autónoma de Baja California Surlocation not on record	1
University of North Carolina, Wilmingtonlocation not on record	1
Columbia, US	1

26 institutions · 566 of 1 601 vouchered records shown · 1 015 without an institution code

09Environmental DNA79 detections

Where the DNA of Mastocarpus papillatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found79

Studies independent surveys2

Countries2

Verifiable raw sequence linked6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 79 detections have coordinates

Open the map2 countries0

intertidal rock

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 10.7–13.6

Seasonal swing summer↔winter8.80 °C

Max temp (day)14.9 °C 12.3–16.3

Min temp (night)11.7 °C 8.40–12.2

Precipitation137 mm/mo 47.3–175

Air humidity65.4 % 61.5–69.3

Moisture balance13.6 mm/mo

Vapour deficit506 Pa 423–538

Wind speed4.10 m/s

Cloud cover40.5 % 37.1–54.6

CHELSA 1981–2010, ~9 km grid, at location & month of 78 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mastocarpus papillatus

At a glance

Sources9 archives

Habitat & environment2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 139 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 139 records