Martensia elegans

Hering · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Ceramiales/Delesseriaceae/Martensia

At a glance

Occurrence records507

Data sources7

Biological traits4

DNA specimens10

eDNA detections5

Sources7 archives

Databases and archives Martensia elegans's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility339 records↗

OBISOcean Biodiversity Information System168 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS507 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Martensia elegans is a red alga species in the genus Martensia. It is a common South African south coast species, extending into KwaZulu-Natal at least as far as Sodwana Bay.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits2

Depth max60 m

Depth min2 m

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Martensia elegans has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes3

GenBank sequences7

eDNA detections5

The DNA barcodea real sequence read deposited for this species

ITSDQ423579.1 ↗303 bp

ACGT

TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACACGTTACCGCACCGGGTGAGGGACGGGG …

Martensia elegans voucher YL1657 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Martensia jejuensissame genus11.1%Pterothamnion villosumsame order14.9%Dichotomaria obtusatasame order15.2%Deltalsia parasiticasame order16.7%Psaromenia septentrionalissame order17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL5★ITS2

animal barcodeplant barcodefungal barcode

08Occurrence & distribution

Record type507 records

Wild obs. + sensor68

Museum / vouchered406

Other33

Origin

Native47

Range

Area of Occupancy AOO836 km²

Depth

0–200 m sunlit33

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 2 m · max 275 m · 34 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 2≤1 km 16≤10 km 4>10 km 3

25 georeferenced · 43 without coordinates

Open the mapobservation + sensor68

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 2≤1 km 48≤10 km 81>10 km 12

143 georeferenced · 263 without coordinates

Open the institutions mapphysical evidence406

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Marine Biodiversity Institute of Korealocation not on record	83
Mount Annan, AU	49
GENTlocation not on record	23
MeiseBGlocation not on record	21
Department of Microbiology, Faculty of Sciencelocation not on record	18
Brisbane, AU	11
Hobart, AU	10
Ann Arbor, US	9
Museo Entomologico de Leonlocation not on record	9
Kensington, AU	8
South Kensington, GB	7
Chapel Hill, US	7
GRAlocation not on record	5
Auckland, NZ	4
Adelaide, AU	3
Bronx, US	3
James Cook Townsvillelocation not on record	3
WTUlocation not on record	2
Pretoria, ZA	2
Cape Town, ZA	2
LDlocation not on record	2
Tampa, US	1
PHlocation not on record	1
Brown Universitylocation not on record	1

24 institutions · 284 of 406 vouchered records shown · 30 without an institution code

09Environmental DNA5 detections

Where the DNA of Martensia elegans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 11.2–21.2

Seasonal swing summer↔winter15.6 °C

Max temp (day)22.1 °C 19.7–28.7

Min temp (night)5.70 °C 4.50–14.5

Precipitation8.20 mm/mo 7.60–48.5

Air humidity48.1 % 45.8–50.6

Moisture balance-84.2 mm/mo -95.1–-59.8

Vapour deficit826 Pa 677–1,335

Wind speed2.90 m/s 2.70–3.10

Cloud cover5.20 % 4.90–20.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)