Marsypopetalum pallidum — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Annonaceae/Marsypopetalum

At a glance

Occurrence records1

Data sources5

Biological traits9

DNA specimens2

eDNA detections2

Sources5 archives

Databases and archives Marsypopetalum pallidum's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF1 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height10.5 m

Plant height max3 m

Seed length22.5 mm

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment3

Climatewet tropical

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Tree (T)

Woodinesswoody

Physiology & chemistry1

Specific leaf area (SLA)14.43 mm²/mg

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Marsypopetalum pallidum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences4

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLLC736494.1 ↗432 bpMalaysia

ACGT

ACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACT …

Marsypopetalum pallidum 3719179 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxgenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2rbcL2

plant barcode

08Occurrence & distribution

Record type1 records

Museum / vouchered1

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

09Environmental DNA2 detections

Where the DNA of Marsypopetalum pallidum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.1 °C 28.1–28.1

Seasonal swing summer↔winter4.40 °C

Max temp (day)31.9 °C

Min temp (night)23.6 °C

Precipitation137 mm/mo

Air humidity59.8 %

Moisture balance-8.90 mm/mo

Vapour deficit1,523 Pa

Wind speed2.20 m/s

Cloud cover38.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.