Marsilea crenata

C.Presl · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Salviniales/Marsileaceae/Marsilea

At a glance

Occurrence records367

Data sources9

Biological traits7

DNA specimens5

eDNA detections5

Sources9 archives

Databases and archives Marsilea crenata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility367 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF367 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Marsilea crenata est une espèce de fougères de la famille des Marsileaceae originaire de l'Asie du Sud-Est. C'est une plante aquatique ressemblant à un trèfle à quatre feuilles. Les feuilles flottent en eau profonde, ou émergent et se dressent en eau peu profonde ou sur terre.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraits

Size & morphology2

Leaf length15 mm

Leaf width6 mm

Life cycle & reproduction1

Life spanperennial

Habitat & environment4

Growth formfern

Leaf compoundnesscompound

Leaf shapeobtriangular widely_obovate

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Marsilea crenata has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes1

GenBank sequences5

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLAB574736.1 ↗1 205 bpJapan

ACGT

TACACTCCCGATTATCAGACCTCACCCCATGATATCTTGGCAGCCTTTAGAATGACCCCGCAACCCGGAGTACCACCTGAGGAAGCTGGA …

Marsilea crenata chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds, specimen_voucher: TNS:763648

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL5

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Marsilea crenata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Chromosome records40–402n range40median40mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 402×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Nakato, N. 1996. Notes on chromosomes of Japanese pteridophytes. J. Jap. Bot. 71: 163–167.

CCDB · ipcn-api-dl — Tindale. 2002. In M. D. Tindale & S. K. Roy, A cytotaxonomic survey of the Pteridophyta of Australia. Austral. Syst. Bot. 15: 839–937.

08Occurrence & distribution

Record type367 records

Wild obs. + sensor71

Museum / vouchered284

Other12

Origin

Native16

Range

Area of Occupancy AOO1 108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 22≤1 km 5≤10 km 10>10 km 5

42 georeferenced · 29 without coordinates

Open the mapobservation + sensor71

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 33≤1 km 21≤10 km 96>10 km 13

163 georeferenced · 121 without coordinates

Open the institutions mapphysical evidence284

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	43
Tsukuba, JP	42
Palmerston, AU	40
Kew, GB	33
Yunnan Universitylocation not on record	29
Nishihara, JP	21
Canberra, AU	16
Mount Annan, AU	9
Museo Entomologico de Leonlocation not on record	9
Beijing, CN	7
Smithfield, AU	4
James Cook Townsvillelocation not on record	4
Taipei, TW	3
Kensington, AU	2
John T. Waterhouse Herbariumlocation not on record	2
Adelaide, AU	2
Nanjing, CN	2
Saint Louis, US	2
Zürich, CH	1
Bronx, US	1
Hobart, AU	1
WTUlocation not on record	1
The Maharaja Sayajirao University of Barodalocation not on record	1
University of Stellenboschlocation not on record	1
Chicago, US	1
Gujarat Biodiversity Gene Banklocation not on record	1
Honolulu, US	1
Minia, EG	1
Armidale, AU	1
Guangzhou, CN	1
Auckland, NZ	1

31 institutions · 283 of 284 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Marsilea crenata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 10.6–24.1

Seasonal swing summer↔winter13.8 °C

Max temp (day)30.1 °C 13.7–30.6

Min temp (night)17.1 °C 5.80–18.3

Precipitation14.3 mm/mo 9.70–278

Air humidity47.3 % 45.5–61.4

Moisture balance-94.7 mm/mo -101–191

Vapour deficit1,572 Pa 657–1,593

Wind speed2.10 m/s 1.90–2.70

Cloud cover7.60 % 7.10–37.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)