Marshallia mohrii

Beadle & F.E.Boynton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Marshallia

At a glance

Occurrence records134

Data sources11

Biological traits7

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Marshallia mohrii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility134 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF134 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Marshallia mohrii, or Mohr's Barbara's buttons, is a perennial herb species, endemic to the Southeastern United States, in several locations in Alabama, Georgia, and Florida.USDA . accessed 12.1.2011 The first recorded discovery of the species was in 1882 by Dr. Charles Mohr, hence the botanical species name and common name. Mohr's Barbara's buttons is currently listed as threatened on the Endangered Species List, and has been since 1988.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition4 compounds

Compounds documented for Marshallia mohrii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavandiols (Leucoanthocyanidins)3

Flavanones1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R,4S,5S,6R)-2-[[(2R,3R,4S)-3,7-dihydroxy-2-(4-hydroxyphenyl)-5-methoxy-8-(3-methylbut-2-enyl)-3,4-dihydro-2H-chromen-4-yl]oxy]-6-[[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxymethyl]oxane-3,4,5-triol	present	LOTUS
(2S,3R,4S,5S,6R)-2-[[(2R,3S,4S)-3,4-dihydroxy-2-(4-hydroxyphenyl)-5-methoxy-8-(3-methylbut-2-enyl)-3,4-dihydro-2H-chromen-7-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2S,3R,4S,5S,6R)-2-[[(2R,3S,4S)-3-hydroxy-2-(4-hydroxyphenyl)-4,5-dimethoxy-8-(3-methylbut-2-enyl)-3,4-dihydro-2H-chromen-7-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
Sophoraflavanone B	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Marshallia mohrii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF349065.1 ↗346 bpUSA · 2015

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAAGCCATCTGGTAGAAGGCACGTCTGCCTGGGCGTCACAATCT …

Marshallia mohrii isolate AD3HI15 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★ITS5

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Marshallia mohrii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Watson, L. E. & J. R. Estes. 1990. Biosystematic and phenetic analysis of Marshallia (Asteraceae). Syst. Bot. 15: 403–414.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type134 records

Wild obs. + sensor126

Museum / vouchered8

Range

Area of Occupancy AOO356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 126

126 georeferenced

Open the mapobservation + sensor126

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	3
Jena Microbial Resource Collectionlocation not on record	2
Chicago, US	1
Saint Louis, US	1

4 institutions · 7 of 8 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Marshallia mohrii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)