Marshallia caespitosa

Nutt. ex DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Marshallia

At a glance

Occurrence records2 058

Data sources10

Biological traits12

DNA specimens5

eDNA detections5

Sources10 archives

Databases and archives Marshallia caespitosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 058 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF2 058 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Marshallia caespitosa là một loài thực vật có hoa trong họ Cúc. Loài này được Nutt. ex DC. mô tả khoa học đầu tiên năm 1836.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass2.2 mg

⚠ sources differ — TRY: 2.2 mg · GIFT: 2.46 mg

Seed mass max2.72 mg

Seed mass min2.2 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Marshallia caespitosa has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences10

eDNA detections5

The DNA barcodea real sequence read deposited for this species

ITSKP715512.1 ↗614 bp

ACGT

TCAAACCTGCACGCAAAAGACCTGTGAACTGTATCAACAATATGGTTTGTGGCTTTTAACCTTTGGTTTGAGACTCATAAAGCCTTGTCA …

Marshallia caespitosa var. caespitosa isolate M26 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Marshallia caespitosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Watson, L. E. & J. R. Estes. 1990. Biosystematic and phenetic analysis of Marshallia (Asteraceae). Syst. Bot. 15: 403–414.

n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Watson, L. E. & J. R. Estes. 1990. Biosystematic and phenetic analysis of Marshallia (Asteraceae). Syst. Bot. 15: 403–414.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 058 records

Wild obs. + sensor1 951

Museum / vouchered107

Range

Area of Occupancy AOO3 256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 1 067≤1 km 232≤10 km 60>10 km 136

1 495 georeferenced · 456 without coordinates

Open the mapobservation + sensor1 951

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 5≤1 km 8≤10 km 31>10 km 11

55 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence107

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Fort Worth, US	42
Austin, US	19
EL PASO, US	9
Philadelphia, US	6
Jena Microbial Resource Collectionlocation not on record	4
Stockholm, SE	3
Lubbock, US	3
Riverside, US	3
Saint Louis, US	2
Bronx, US	2
Denton, US	2
Davis, US	2
Pittsburg, US	1
Tempe, US	1
BAYLUlocation not on record	1
Taipei, TW	1
DOI/NPS, Greenbelt Parklocation not on record	1
Waverly, US	1
Tampa, US	1
Stephenville, US	1
Denver, US	1
Kew, GB	1

22 institutions · 107 of 107 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Marshallia caespitosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Marshallia caespitosa

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 058 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 058 records