Maratus scutulatus

(L.Koch, 1881) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Salticidae/Maratus

At a glance

Occurrence records3 008

Data sources8

Biological traits0

DNA specimens27

eDNA detections1

Sources8 archives

Databases and archives Maratus scutulatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 008 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 008 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD27 specimens

01Narrative

Maratus scutulatus is a species of Australian spider in the family Salticidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Maratus scutulatus has left across the world's sequence archives.

At a glance

DNA specimens27

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 67 variable positions, in barcode order

1Tmostly conserved

2Amostly conserved

3Cmostly conserved

5Tmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

11Cmostly conserved

13Gvariable

14Amostly conserved

15Tmostly conserved

16Tmostly conserved

17Tmostly conserved

18Tmostly conserved

20Gmostly conserved

23Gmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

31Gmostly conserved

34Tmostly conserved

35Amostly conserved

36Tmostly conserved

38Gmostly conserved

40Cmostly conserved

42Gmostly conserved

45Cmostly conserved

46Gmostly conserved

47Gmostly conserved

48Cmostly conserved

50Amostly conserved

53Amostly conserved

54Gmostly conserved

56Gmostly conserved

58Amostly conserved

59Tmostly conserved

60Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Amostly conserved

72Amostly conserved

73Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

80Cmostly conserved

81Amostly conserved

82Amostly conserved

84Cmostly conserved

86Gmostly conserved

87Gmostly conserved

89Amostly conserved

90Amostly conserved

91Tmostly conserved

166Gmostly conserved

175Gmostly conserved

190Amostly conserved

268Amostly conserved

370Tmostly conserved

430Amostly conserved

433Gvariable

562Gmostly conserved

TACTTTATATCTGATTTTTGGAGCTTGATCGGCTATAGCCGGAACGGCAATAAGAGTATTAATTCGAATAGAATTAGGTCAAACTGGTAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes6

BIN1

Most divergent pair1.1%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euophrys cochleasame family10.5%Plexippus paykullisame family10.5%Myrmarachne solitariasame family10.6%Thyenula tenebricasame family10.6%Rumburak laxussame family10.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 008 records

Wild obs. + sensor2 845

Museum / vouchered163

Range

Area of Occupancy AOO5 660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 896≤1 km 712≤10 km 160>10 km 389

2 157 georeferenced · 688 without coordinates

Open the mapobservation + sensor2 845

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 25≤1 km 4≤10 km 30

59 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence163

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	147
QVMAGlocation not on record	7
Museums Victorialocation not on record	5
Australian National Fish Collectionlocation not on record	3
Tasmanian Museum & Art Gallerylocation not on record	1

5 institutions · 163 of 163 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Maratus scutulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 16.4–16.4

Seasonal swing summer↔winter9.80 °C

Max temp (day)19.2 °C

Min temp (night)13.7 °C

Precipitation46.4 mm/mo

Air humidity55.5 %

Moisture balance-55.7 mm/mo

Vapour deficit860 Pa

Wind speed2.50 m/s

Cloud cover17.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Maratus scutulatus

At a glance

Sources8 archives

At a glance

Record type3 008 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 008 records